Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0919214450:

Variant ID: vg0919214450 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 19214450
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GGGGTGTGGTTAACGGGCGATCGATCACTTGGAGCGATCACCCCCTATCCCCTCCTATACGCTCCTCTCCCCCTTTCTCCTCAGTTTCTTCTCTTCCTAC[T/C]
ACACTATAAAATTTTAAAAAAATAAAAAACAAAGTTGGAAAAAATTATGTATAGAAATACTATATATAAAAAAGTATTTGAATTCAAATTTAAAATGGGT

Reverse complement sequence

ACCCATTTTAAATTTGAATTCAAATACTTTTTTATATATAGTATTTCTATACATAATTTTTTCCAACTTTGTTTTTTATTTTTTTAAAATTTTATAGTGT[A/G]
GTAGGAAGAGAAGAAACTGAGGAGAAAGGGGGAGAGGAGCGTATAGGAGGGGATAGGGGGTGATCGCTCCAAGTGATCGATCGCCCGTTAACCACACCCC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	71.70%	3.30%	1.59%	23.47%	NA
All Indica	2759	64.60%	5.50%	2.32%	27.62%	NA
All Japonica	1512	99.60%	0.00%	0.07%	0.33%	NA
Aus	269	5.20%	0.00%	2.60%	92.19%	NA
Indica I	595	21.70%	8.90%	4.37%	65.04%	NA
Indica II	465	74.60%	11.60%	2.37%	11.40%	NA
Indica III	913	85.40%	0.00%	0.99%	13.58%	NA
Indica Intermediate	786	66.80%	5.70%	2.29%	25.19%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	97.50%	0.00%	0.41%	2.07%	NA
VI/Aromatic	96	25.00%	0.00%	1.04%	73.96%	NA
Intermediate	90	70.00%	2.20%	2.22%	25.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0919214450	T -> DEL	N	N	silent_mutation	Average:43.111; most accessible tissue: Zhenshan97 flower, score: 85.314	N	N	N	N
vg0919214450	T -> C	LOC_Os09g32190.1	upstream_gene_variant ; 1808.0bp to feature; MODIFIER	silent_mutation	Average:43.111; most accessible tissue: Zhenshan97 flower, score: 85.314	N	N	N	N
vg0919214450	T -> C	LOC_Os09g32200.1	upstream_gene_variant ; 1426.0bp to feature; MODIFIER	silent_mutation	Average:43.111; most accessible tissue: Zhenshan97 flower, score: 85.314	N	N	N	N
vg0919214450	T -> C	LOC_Os09g32190-LOC_Os09g32200	intergenic_region ; MODIFIER	silent_mutation	Average:43.111; most accessible tissue: Zhenshan97 flower, score: 85.314	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0919214450	NA	2.07E-06	mr1138	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919214450	NA	7.79E-11	mr1707	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919214450	NA	4.34E-07	mr1707	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919214450	9.34E-08	4.61E-15	mr1728	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919214450	1.40E-06	5.58E-10	mr1728	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919214450	NA	1.87E-08	mr1860	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919214450	NA	9.64E-06	mr1860	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919214450	1.49E-06	5.39E-13	mr1707_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919214450	NA	3.09E-08	mr1707_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919214450	3.35E-06	9.28E-13	mr1728_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919214450	NA	3.25E-07	mr1728_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251