\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0919214450:

Variant ID: vg0919214450 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 19214450
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GGGGTGTGGTTAACGGGCGATCGATCACTTGGAGCGATCACCCCCTATCCCCTCCTATACGCTCCTCTCCCCCTTTCTCCTCAGTTTCTTCTCTTCCTAC[T/C]
ACACTATAAAATTTTAAAAAAATAAAAAACAAAGTTGGAAAAAATTATGTATAGAAATACTATATATAAAAAAGTATTTGAATTCAAATTTAAAATGGGT

Reverse complement sequence

ACCCATTTTAAATTTGAATTCAAATACTTTTTTATATATAGTATTTCTATACATAATTTTTTCCAACTTTGTTTTTTATTTTTTTAAAATTTTATAGTGT[A/G]
GTAGGAAGAGAAGAAACTGAGGAGAAAGGGGGAGAGGAGCGTATAGGAGGGGATAGGGGGTGATCGCTCCAAGTGATCGATCGCCCGTTAACCACACCCC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 71.70% 3.30% 1.59% 23.47% NA
All Indica  2759 64.60% 5.50% 2.32% 27.62% NA
All Japonica  1512 99.60% 0.00% 0.07% 0.33% NA
Aus  269 5.20% 0.00% 2.60% 92.19% NA
Indica I  595 21.70% 8.90% 4.37% 65.04% NA
Indica II  465 74.60% 11.60% 2.37% 11.40% NA
Indica III  913 85.40% 0.00% 0.99% 13.58% NA
Indica Intermediate  786 66.80% 5.70% 2.29% 25.19% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 97.50% 0.00% 0.41% 2.07% NA
VI/Aromatic  96 25.00% 0.00% 1.04% 73.96% NA
Intermediate  90 70.00% 2.20% 2.22% 25.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0919214450 T -> DEL N N silent_mutation Average:43.111; most accessible tissue: Zhenshan97 flower, score: 85.314 N N N N
vg0919214450 T -> C LOC_Os09g32190.1 upstream_gene_variant ; 1808.0bp to feature; MODIFIER silent_mutation Average:43.111; most accessible tissue: Zhenshan97 flower, score: 85.314 N N N N
vg0919214450 T -> C LOC_Os09g32200.1 upstream_gene_variant ; 1426.0bp to feature; MODIFIER silent_mutation Average:43.111; most accessible tissue: Zhenshan97 flower, score: 85.314 N N N N
vg0919214450 T -> C LOC_Os09g32190-LOC_Os09g32200 intergenic_region ; MODIFIER silent_mutation Average:43.111; most accessible tissue: Zhenshan97 flower, score: 85.314 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0919214450 NA 2.07E-06 mr1138 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919214450 NA 7.79E-11 mr1707 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919214450 NA 4.34E-07 mr1707 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919214450 9.34E-08 4.61E-15 mr1728 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919214450 1.40E-06 5.58E-10 mr1728 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919214450 NA 1.87E-08 mr1860 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919214450 NA 9.64E-06 mr1860 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919214450 1.49E-06 5.39E-13 mr1707_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919214450 NA 3.09E-08 mr1707_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919214450 3.35E-06 9.28E-13 mr1728_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919214450 NA 3.25E-07 mr1728_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251