\
| Variant ID: vg0919214450 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 19214450 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
GGGGTGTGGTTAACGGGCGATCGATCACTTGGAGCGATCACCCCCTATCCCCTCCTATACGCTCCTCTCCCCCTTTCTCCTCAGTTTCTTCTCTTCCTAC[T/C]
ACACTATAAAATTTTAAAAAAATAAAAAACAAAGTTGGAAAAAATTATGTATAGAAATACTATATATAAAAAAGTATTTGAATTCAAATTTAAAATGGGT
ACCCATTTTAAATTTGAATTCAAATACTTTTTTATATATAGTATTTCTATACATAATTTTTTCCAACTTTGTTTTTTATTTTTTTAAAATTTTATAGTGT[A/G]
GTAGGAAGAGAAGAAACTGAGGAGAAAGGGGGAGAGGAGCGTATAGGAGGGGATAGGGGGTGATCGCTCCAAGTGATCGATCGCCCGTTAACCACACCCC
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 71.70% | 3.30% | 1.59% | 23.47% | NA |
| All Indica | 2759 | 64.60% | 5.50% | 2.32% | 27.62% | NA |
| All Japonica | 1512 | 99.60% | 0.00% | 0.07% | 0.33% | NA |
| Aus | 269 | 5.20% | 0.00% | 2.60% | 92.19% | NA |
| Indica I | 595 | 21.70% | 8.90% | 4.37% | 65.04% | NA |
| Indica II | 465 | 74.60% | 11.60% | 2.37% | 11.40% | NA |
| Indica III | 913 | 85.40% | 0.00% | 0.99% | 13.58% | NA |
| Indica Intermediate | 786 | 66.80% | 5.70% | 2.29% | 25.19% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 97.50% | 0.00% | 0.41% | 2.07% | NA |
| VI/Aromatic | 96 | 25.00% | 0.00% | 1.04% | 73.96% | NA |
| Intermediate | 90 | 70.00% | 2.20% | 2.22% | 25.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0919214450 | T -> DEL | N | N | silent_mutation | Average:43.111; most accessible tissue: Zhenshan97 flower, score: 85.314 | N | N | N | N |
| vg0919214450 | T -> C | LOC_Os09g32190.1 | upstream_gene_variant ; 1808.0bp to feature; MODIFIER | silent_mutation | Average:43.111; most accessible tissue: Zhenshan97 flower, score: 85.314 | N | N | N | N |
| vg0919214450 | T -> C | LOC_Os09g32200.1 | upstream_gene_variant ; 1426.0bp to feature; MODIFIER | silent_mutation | Average:43.111; most accessible tissue: Zhenshan97 flower, score: 85.314 | N | N | N | N |
| vg0919214450 | T -> C | LOC_Os09g32190-LOC_Os09g32200 | intergenic_region ; MODIFIER | silent_mutation | Average:43.111; most accessible tissue: Zhenshan97 flower, score: 85.314 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0919214450 | NA | 2.07E-06 | mr1138 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0919214450 | NA | 7.79E-11 | mr1707 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0919214450 | NA | 4.34E-07 | mr1707 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0919214450 | 9.34E-08 | 4.61E-15 | mr1728 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0919214450 | 1.40E-06 | 5.58E-10 | mr1728 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0919214450 | NA | 1.87E-08 | mr1860 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0919214450 | NA | 9.64E-06 | mr1860 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0919214450 | 1.49E-06 | 5.39E-13 | mr1707_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0919214450 | NA | 3.09E-08 | mr1707_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0919214450 | 3.35E-06 | 9.28E-13 | mr1728_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0919214450 | NA | 3.25E-07 | mr1728_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |