\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0919172348:

Variant ID: vg0919172348 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 19172348
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AAATTGATTTTCCTGTGCGGGCGACGGTCCAGCTCCGGTCCACCTATTTTTCTGTGCGGTTTCACTTACGGCCCGCCTGTAAATTAAACGGTCCGGCGTC[C/A]
AGGAAAATATTTGCTGTAGTAGTGTGAGTAGCATAGAAATTATTTTCTCTACAAATATATAGTTTTAGAAAAGAATGAAACTTTAAAAACTTTCAACATT

Reverse complement sequence

AATGTTGAAAGTTTTTAAAGTTTCATTCTTTTCTAAAACTATATATTTGTAGAGAAAATAATTTCTATGCTACTCACACTACTACAGCAAATATTTTCCT[G/T]
GACGCCGGACCGTTTAATTTACAGGCGGGCCGTAAGTGAAACCGCACAGAAAAATAGGTGGACCGGAGCTGGACCGTCGCCCGCACAGGAAAATCAATTT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 59.40% 16.10% 0.17% 24.35% NA
All Indica  2759 43.70% 27.30% 0.29% 28.71% NA
All Japonica  1512 99.60% 0.00% 0.00% 0.40% NA
Aus  269 4.50% 0.70% 0.00% 94.80% NA
Indica I  595 6.10% 26.60% 0.34% 67.06% NA
Indica II  465 71.00% 16.80% 0.22% 12.04% NA
Indica III  913 53.50% 31.80% 0.44% 14.35% NA
Indica Intermediate  786 44.90% 28.80% 0.13% 26.21% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 97.50% 0.00% 0.00% 2.49% NA
VI/Aromatic  96 21.90% 1.00% 0.00% 77.08% NA
Intermediate  90 67.80% 5.60% 0.00% 26.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0919172348 C -> DEL N N silent_mutation Average:26.079; most accessible tissue: Zhenshan97 panicle, score: 74.671 N N N N
vg0919172348 C -> A LOC_Os09g32120.1 upstream_gene_variant ; 2029.0bp to feature; MODIFIER silent_mutation Average:26.079; most accessible tissue: Zhenshan97 panicle, score: 74.671 N N N N
vg0919172348 C -> A LOC_Os09g32100.1 downstream_gene_variant ; 4504.0bp to feature; MODIFIER silent_mutation Average:26.079; most accessible tissue: Zhenshan97 panicle, score: 74.671 N N N N
vg0919172348 C -> A LOC_Os09g32100-LOC_Os09g32120 intergenic_region ; MODIFIER silent_mutation Average:26.079; most accessible tissue: Zhenshan97 panicle, score: 74.671 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0919172348 NA 7.94E-06 mr1060 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919172348 NA 1.94E-07 mr1138 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919172348 NA 1.67E-06 mr1607 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919172348 NA 1.19E-12 mr1707 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919172348 NA 1.20E-07 mr1707 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919172348 NA 8.63E-06 mr1713 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919172348 NA 1.72E-13 mr1728 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919172348 NA 3.34E-08 mr1728 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919172348 NA 7.06E-11 mr1860 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919172348 NA 6.35E-07 mr1860 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919172348 NA 7.38E-06 mr1138_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919172348 NA 3.84E-10 mr1707_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919172348 NA 8.76E-06 mr1707_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919172348 NA 9.18E-12 mr1728_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919172348 NA 3.83E-09 mr1860_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251