\
| Variant ID: vg0919164093 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 19164093 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
ACTGTACTAGTGTAATGGTAGAAATCAAATTTAAACCGTGTTAGCCTGGCAATTTTAAATGCTAGTTAACTTGTATTTAACTATAATATAACTTGTATAT[A/G]
GCTTTTAAAAATCCAATGGTCGTAAAACGGAGGTCGTGGGACCGAATCCCCTCATCTATGCCCATGCTGTGATTTTTTTTCCTTCCTAGTTTGCGCGAAT
ATTCGCGCAAACTAGGAAGGAAAAAAAATCACAGCATGGGCATAGATGAGGGGATTCGGTCCCACGACCTCCGTTTTACGACCATTGGATTTTTAAAAGC[T/C]
ATATACAAGTTATATTATAGTTAAATACAAGTTAACTAGCATTTAAAATTGCCAGGCTAACACGGTTTAAATTTGATTTCTACCATTACACTAGTACAGT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 84.00% | 15.90% | 0.15% | 0.00% | NA |
| All Indica | 2759 | 72.70% | 27.00% | 0.25% | 0.00% | NA |
| All Japonica | 1512 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 74.10% | 25.90% | 0.00% | 0.00% | NA |
| Indica II | 465 | 83.40% | 15.90% | 0.65% | 0.00% | NA |
| Indica III | 913 | 67.80% | 31.90% | 0.33% | 0.00% | NA |
| Indica Intermediate | 786 | 71.10% | 28.80% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 93.30% | 6.70% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0919164093 | A -> G | LOC_Os09g32095.1 | upstream_gene_variant ; 4602.0bp to feature; MODIFIER | silent_mutation | Average:44.473; most accessible tissue: Zhenshan97 panicle, score: 65.386 | N | N | N | N |
| vg0919164093 | A -> G | LOC_Os09g32100.1 | upstream_gene_variant ; 2257.0bp to feature; MODIFIER | silent_mutation | Average:44.473; most accessible tissue: Zhenshan97 panicle, score: 65.386 | N | N | N | N |
| vg0919164093 | A -> G | LOC_Os09g32095-LOC_Os09g32100 | intergenic_region ; MODIFIER | silent_mutation | Average:44.473; most accessible tissue: Zhenshan97 panicle, score: 65.386 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0919164093 | NA | 8.31E-06 | mr1002 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0919164093 | NA | 4.28E-06 | mr1138 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0919164093 | NA | 3.77E-06 | mr1607 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0919164093 | NA | 4.63E-13 | mr1707 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0919164093 | NA | 6.23E-08 | mr1707 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0919164093 | NA | 1.38E-13 | mr1728 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0919164093 | NA | 2.84E-08 | mr1728 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0919164093 | NA | 4.78E-10 | mr1860 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0919164093 | NA | 2.83E-06 | mr1860 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0919164093 | NA | 6.28E-10 | mr1707_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0919164093 | NA | 2.82E-11 | mr1728_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0919164093 | NA | 1.34E-08 | mr1860_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |