Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0919142743:

Variant ID: vg0919142743 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 19142743
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.93, G: 0.08, others allele: 0.00, population size: 218. )

Flanking Sequence (100 bp) in Reference Genome:

CTCATCAAGTCAGCAACATGGTTAGAACGCCTTTGCCTCCTCAAGTTACATCAGTTCCTATATGAAGTGGTCAGATCCAGTCCAATGACACTAGAAAGAG[G/A]
AGTGCTTCCAATAGTCACTTGATAGTAAAGTTTCCATCTTGCTGAATTGTCATTAAAGGCACCGATAAAGATTCTATTGTTTCGCTAGCAACCGCTTCAA

Reverse complement sequence

TTGAAGCGGTTGCTAGCGAAACAATAGAATCTTTATCGGTGCCTTTAATGACAATTCAGCAAGATGGAAACTTTACTATCAAGTGACTATTGGAAGCACT[C/T]
CTCTTTCTAGTGTCATTGGACTGGATCTGACCACTTCATATAGGAACTGATGTAACTTGAGGAGGCAAAGGCGTTCTAACCATGTTGCTGACTTGATGAG

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	41.00%	35.50%	11.09%	12.38%	NA
All Indica	2759	68.90%	3.20%	10.84%	17.07%	NA
All Japonica	1512	0.10%	99.70%	0.00%	0.20%	NA
Aus	269	7.80%	3.30%	73.23%	15.61%	NA
Indica I	595	29.20%	4.90%	26.39%	39.50%	NA
Indica II	465	83.70%	4.90%	1.51%	9.89%	NA
Indica III	913	84.80%	0.90%	6.35%	8.00%	NA
Indica Intermediate	786	71.60%	3.70%	9.80%	14.89%	NA
Temperate Japonica	767	0.00%	99.90%	0.00%	0.13%	NA
Tropical Japonica	504	0.00%	100.00%	0.00%	0.00%	NA
Japonica Intermediate	241	0.80%	98.30%	0.00%	0.83%	NA
VI/Aromatic	96	1.00%	22.90%	15.62%	60.42%	NA
Intermediate	90	16.70%	56.70%	14.44%	12.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0919142743	G -> DEL	N	N	silent_mutation	Average:23.925; most accessible tissue: Callus, score: 52.55	N	N	N	N
vg0919142743	G -> A	LOC_Os09g32070.1	downstream_gene_variant ; 4820.0bp to feature; MODIFIER	silent_mutation	Average:23.925; most accessible tissue: Callus, score: 52.55	N	N	N	N
vg0919142743	G -> A	LOC_Os09g32070-LOC_Os09g32080	intergenic_region ; MODIFIER	silent_mutation	Average:23.925; most accessible tissue: Callus, score: 52.55	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0919142743	NA	6.64E-106	mr1008	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919142743	NA	1.18E-102	mr1009	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919142743	NA	2.94E-69	mr1014	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919142743	NA	4.72E-23	mr1518	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919142743	NA	1.41E-08	mr1518	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919142743	NA	1.20E-23	mr1676	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919142743	NA	1.04E-08	mr1676	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919142743	NA	3.51E-37	mr1719	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919142743	NA	4.14E-13	mr1740	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919142743	NA	3.27E-13	mr1874	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919142743	NA	3.70E-53	mr1141_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919142743	NA	3.67E-21	mr1175_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919142743	NA	5.61E-19	mr1195_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919142743	NA	1.30E-14	mr1277_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919142743	NA	2.67E-17	mr1342_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919142743	NA	1.25E-25	mr1403_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919142743	NA	3.18E-07	mr1408_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919142743	NA	6.80E-16	mr1416_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919142743	NA	8.81E-45	mr1486_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919142743	NA	7.62E-11	mr1537_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919142743	NA	1.52E-47	mr1546_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919142743	1.89E-06	NA	mr1598_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919142743	NA	9.32E-20	mr1637_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919142743	NA	2.40E-18	mr1657_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919142743	NA	5.38E-26	mr1676_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919142743	NA	3.02E-09	mr1676_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919142743	NA	6.28E-08	mr1700_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251