\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0919142743:

Variant ID: vg0919142743 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 19142743
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.93, G: 0.08, others allele: 0.00, population size: 218. )

Flanking Sequence (100 bp) in Reference Genome:


CTCATCAAGTCAGCAACATGGTTAGAACGCCTTTGCCTCCTCAAGTTACATCAGTTCCTATATGAAGTGGTCAGATCCAGTCCAATGACACTAGAAAGAG[G/A]
AGTGCTTCCAATAGTCACTTGATAGTAAAGTTTCCATCTTGCTGAATTGTCATTAAAGGCACCGATAAAGATTCTATTGTTTCGCTAGCAACCGCTTCAA

Reverse complement sequence

TTGAAGCGGTTGCTAGCGAAACAATAGAATCTTTATCGGTGCCTTTAATGACAATTCAGCAAGATGGAAACTTTACTATCAAGTGACTATTGGAAGCACT[C/T]
CTCTTTCTAGTGTCATTGGACTGGATCTGACCACTTCATATAGGAACTGATGTAACTTGAGGAGGCAAAGGCGTTCTAACCATGTTGCTGACTTGATGAG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 41.00% 35.50% 11.09% 12.38% NA
All Indica  2759 68.90% 3.20% 10.84% 17.07% NA
All Japonica  1512 0.10% 99.70% 0.00% 0.20% NA
Aus  269 7.80% 3.30% 73.23% 15.61% NA
Indica I  595 29.20% 4.90% 26.39% 39.50% NA
Indica II  465 83.70% 4.90% 1.51% 9.89% NA
Indica III  913 84.80% 0.90% 6.35% 8.00% NA
Indica Intermediate  786 71.60% 3.70% 9.80% 14.89% NA
Temperate Japonica  767 0.00% 99.90% 0.00% 0.13% NA
Tropical Japonica  504 0.00% 100.00% 0.00% 0.00% NA
Japonica Intermediate  241 0.80% 98.30% 0.00% 0.83% NA
VI/Aromatic  96 1.00% 22.90% 15.62% 60.42% NA
Intermediate  90 16.70% 56.70% 14.44% 12.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0919142743 G -> DEL N N silent_mutation Average:23.925; most accessible tissue: Callus, score: 52.55 N N N N
vg0919142743 G -> A LOC_Os09g32070.1 downstream_gene_variant ; 4820.0bp to feature; MODIFIER silent_mutation Average:23.925; most accessible tissue: Callus, score: 52.55 N N N N
vg0919142743 G -> A LOC_Os09g32070-LOC_Os09g32080 intergenic_region ; MODIFIER silent_mutation Average:23.925; most accessible tissue: Callus, score: 52.55 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0919142743 NA 6.64E-106 mr1008 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919142743 NA 1.18E-102 mr1009 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919142743 NA 2.94E-69 mr1014 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919142743 NA 4.72E-23 mr1518 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919142743 NA 1.41E-08 mr1518 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919142743 NA 1.20E-23 mr1676 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919142743 NA 1.04E-08 mr1676 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919142743 NA 3.51E-37 mr1719 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919142743 NA 4.14E-13 mr1740 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919142743 NA 3.27E-13 mr1874 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919142743 NA 3.70E-53 mr1141_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919142743 NA 3.67E-21 mr1175_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919142743 NA 5.61E-19 mr1195_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919142743 NA 1.30E-14 mr1277_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919142743 NA 2.67E-17 mr1342_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919142743 NA 1.25E-25 mr1403_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919142743 NA 3.18E-07 mr1408_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919142743 NA 6.80E-16 mr1416_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919142743 NA 8.81E-45 mr1486_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919142743 NA 7.62E-11 mr1537_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919142743 NA 1.52E-47 mr1546_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919142743 1.89E-06 NA mr1598_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919142743 NA 9.32E-20 mr1637_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919142743 NA 2.40E-18 mr1657_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919142743 NA 5.38E-26 mr1676_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919142743 NA 3.02E-09 mr1676_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919142743 NA 6.28E-08 mr1700_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251