\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0919141927:

Variant ID: vg0919141927 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 19141927
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.51, C: 0.49, others allele: 0.00, population size: 85. )

Flanking Sequence (100 bp) in Reference Genome:


GAGGGAACAACAGGATTGAATTGAGATCCTGGCACGACTTAGACTCTGACACAAAGAACGAAAATTTTCGCAATTAGGATTTTGCCGAATTAGTTTTTAA[T/C]
GTCTCACGAAAAGCGGAGCGTTACAACCTGCAACCTCAGACAGTACGCCACCAAGTCTTCAGCAGACCAGCACAGCCAAGCCACCACTAATCCTAGGAGC

Reverse complement sequence

GCTCCTAGGATTAGTGGTGGCTTGGCTGTGCTGGTCTGCTGAAGACTTGGTGGCGTACTGTCTGAGGTTGCAGGTTGTAACGCTCCGCTTTTCGTGAGAC[A/G]
TTAAAAACTAATTCGGCAAAATCCTAATTGCGAAAATTTTCGTTCTTTGTGTCAGAGTCTAAGTCGTGCCAGGATCTCAATTCAATCCTGTTGTTCCCTC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 40.90% 35.30% 6.83% 17.05% NA
All Indica  2759 69.00% 3.00% 8.45% 19.50% NA
All Japonica  1512 0.10% 99.70% 0.07% 0.13% NA
Aus  269 3.00% 2.60% 14.87% 79.55% NA
Indica I  595 29.20% 4.20% 18.32% 48.24% NA
Indica II  465 84.10% 4.70% 2.58% 8.60% NA
Indica III  913 85.00% 1.00% 6.35% 7.67% NA
Indica Intermediate  786 71.60% 3.60% 6.87% 17.94% NA
Temperate Japonica  767 0.00% 99.90% 0.13% 0.00% NA
Tropical Japonica  504 0.00% 100.00% 0.00% 0.00% NA
Japonica Intermediate  241 0.80% 98.30% 0.00% 0.83% NA
VI/Aromatic  96 0.00% 22.90% 38.54% 38.54% NA
Intermediate  90 18.90% 51.10% 13.33% 16.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0919141927 T -> DEL N N silent_mutation Average:25.304; most accessible tissue: Zhenshan97 flag leaf, score: 46.427 N N N N
vg0919141927 T -> C LOC_Os09g32070.1 downstream_gene_variant ; 4004.0bp to feature; MODIFIER silent_mutation Average:25.304; most accessible tissue: Zhenshan97 flag leaf, score: 46.427 N N N N
vg0919141927 T -> C LOC_Os09g32070-LOC_Os09g32080 intergenic_region ; MODIFIER silent_mutation Average:25.304; most accessible tissue: Zhenshan97 flag leaf, score: 46.427 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0919141927 NA 5.24E-10 mr1322 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919141927 NA 2.05E-11 mr1325 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919141927 NA 1.14E-13 mr1326 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919141927 NA 2.59E-06 mr1518 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919141927 NA 1.64E-06 mr1527 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919141927 NA 3.35E-06 mr1532 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919141927 NA 2.23E-10 mr1623 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919141927 NA 2.45E-08 mr1299_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919141927 1.22E-07 1.22E-07 mr1369_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919141927 NA 4.92E-07 mr1408_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919141927 1.70E-08 1.70E-08 mr1453_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919141927 NA 7.58E-08 mr1623_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919141927 NA 3.46E-21 mr1676_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919141927 NA 2.48E-07 mr1676_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919141927 NA 1.15E-06 mr1682_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919141927 NA 8.29E-09 mr1700_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251