\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0919040682:

Variant ID: vg0919040682 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 19040682
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGGGATGTCCTCATCATCCTCCCCCTCTTGAAAAGGAGTCGACCTCGACGACTCTGAATCTTCTAGTCCAAAGAATGGTGTTAAGTCAGCAACATTGAAG[G/A]
TTGGACTAACACCATAATCTTCAGGTAGCTCAATCTTGTAAGCATTGTCATTGATCTTGGACAGCACTCTGAATGGTCCATCTCCTCGTGGCATCAACTT

Reverse complement sequence

AAGTTGATGCCACGAGGAGATGGACCATTCAGAGTGCTGTCCAAGATCAATGACAATGCTTACAAGATTGAGCTACCTGAAGATTATGGTGTTAGTCCAA[C/T]
CTTCAATGTTGCTGACTTAACACCATTCTTTGGACTAGAAGATTCAGAGTCGTCGAGGTCGACTCCTTTTCAAGAGGGGGAGGATGATGAGGACATCCCA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 32.80% 3.70% 10.14% 53.41% NA
All Indica  2759 4.50% 0.00% 15.66% 79.78% NA
All Japonica  1512 87.50% 10.80% 1.39% 0.26% NA
Aus  269 11.90% 0.00% 4.46% 83.64% NA
Indica I  595 5.00% 0.20% 15.46% 79.33% NA
Indica II  465 5.80% 0.00% 13.76% 80.43% NA
Indica III  913 2.40% 0.00% 18.40% 79.19% NA
Indica Intermediate  786 5.90% 0.00% 13.74% 80.41% NA
Temperate Japonica  767 81.40% 16.20% 2.48% 0.00% NA
Tropical Japonica  504 99.20% 0.80% 0.00% 0.00% NA
Japonica Intermediate  241 82.60% 14.90% 0.83% 1.66% NA
VI/Aromatic  96 19.80% 8.30% 8.33% 63.54% NA
Intermediate  90 55.60% 1.10% 6.67% 36.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0919040682 G -> DEL LOC_Os09g31930.1 N frameshift_variant Average:11.567; most accessible tissue: Zhenshan97 panicle, score: 24.575 N N N N
vg0919040682 G -> A LOC_Os09g31930.1 missense_variant ; p.Thr503Ile; MODERATE nonsynonymous_codon ; T503I Average:11.567; most accessible tissue: Zhenshan97 panicle, score: 24.575 unknown unknown TOLERATED 0.20

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0919040682 NA 7.84E-20 Awn_length All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0919040682 NA 2.19E-09 Awn_length Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0919040682 NA 7.72E-06 mr1201 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919040682 NA 8.67E-08 mr1382 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919040682 NA 7.91E-06 mr1395 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919040682 3.60E-06 NA mr1484 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919040682 NA 4.33E-06 mr1619 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919040682 8.66E-06 NA mr1945 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919040682 7.11E-06 NA mr1024_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919040682 5.55E-06 1.35E-11 mr1057_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919040682 NA 3.62E-07 mr1127_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919040682 NA 5.68E-07 mr1167_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919040682 NA 9.25E-06 mr1263_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919040682 NA 4.65E-07 mr1465_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919040682 NA 1.51E-07 mr1482_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919040682 NA 4.84E-06 mr1565_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919040682 NA 1.15E-10 mr1624_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919040682 NA 8.56E-08 mr1624_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919040682 8.38E-06 NA mr1667_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919040682 1.69E-06 NA mr1681_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919040682 1.26E-06 1.26E-06 mr1681_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919040682 NA 3.04E-08 mr1726_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919040682 1.56E-06 NA mr1733_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919040682 NA 5.34E-07 mr1733_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919040682 4.98E-06 1.59E-08 mr1736_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919040682 NA 7.69E-06 mr1736_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919040682 NA 4.30E-07 mr1740_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919040682 NA 1.02E-10 mr1741_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919040682 NA 3.58E-06 mr1741_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919040682 NA 4.97E-06 mr1785_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919040682 NA 8.76E-10 mr1829_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919040682 7.63E-06 7.63E-06 mr1950_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251