| Variant ID: vg0919039056 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 19039056 |
| Reference Allele: G | Alternative Allele: C,A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 34. )
AAAACCTTCCGCATGTACCCAAACGACGGTAAAAATCCCCAATTTTTGCAGGCGGACAAAAGCCCCGCCTGCTAAAATGATTTTTGCAGGCAGCCGTTCT[G/C,A]
TCACGCCCCGAACTAGTACCGACCGGAACTAGCCCGTGACGCTCCAATTTAACCTGTTAATCGATACCAGTCCCAGGACACAGTGCTGGTATCACAGGAA
TTCCTGTGATACCAGCACTGTGTCCTGGGACTGGTATCGATTAACAGGTTAAATTGGAGCGTCACGGGCTAGTTCCGGTCGGTACTAGTTCGGGGCGTGA[C/G,T]
AGAACGGCTGCCTGCAAAAATCATTTTAGCAGGCGGGGCTTTTGTCCGCCTGCAAAAATTGGGGATTTTTACCGTCGTTTGGGTACATGCGGAAGGTTTT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 34.40% | 1.80% | 28.29% | 35.06% | C: 0.49% |
| All Indica | 2759 | 5.50% | 0.00% | 45.56% | 48.21% | C: 0.76% |
| All Japonica | 1512 | 92.30% | 5.00% | 2.31% | 0.33% | NA |
| Aus | 269 | 3.70% | 0.00% | 12.64% | 83.27% | C: 0.37% |
| Indica I | 595 | 5.70% | 0.00% | 22.02% | 71.93% | C: 0.34% |
| Indica II | 465 | 8.20% | 0.00% | 49.89% | 41.29% | C: 0.65% |
| Indica III | 913 | 4.40% | 0.00% | 61.88% | 32.42% | C: 1.31% |
| Indica Intermediate | 786 | 5.00% | 0.00% | 41.86% | 52.67% | C: 0.51% |
| Temperate Japonica | 767 | 90.70% | 5.00% | 4.30% | 0.00% | NA |
| Tropical Japonica | 504 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 82.60% | 14.50% | 0.83% | 2.07% | NA |
| VI/Aromatic | 96 | 19.80% | 7.30% | 2.08% | 70.83% | NA |
| Intermediate | 90 | 54.40% | 1.10% | 10.00% | 33.33% | C: 1.11% |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0919039056 | G -> DEL | N | N | silent_mutation | Average:28.053; most accessible tissue: Callus, score: 53.007 | N | N | N | N |
| vg0919039056 | G -> C | LOC_Os09g31522.1 | upstream_gene_variant ; 4964.0bp to feature; MODIFIER | silent_mutation | Average:28.053; most accessible tissue: Callus, score: 53.007 | N | N | N | N |
| vg0919039056 | G -> C | LOC_Os09g31930.1 | downstream_gene_variant ; 690.0bp to feature; MODIFIER | silent_mutation | Average:28.053; most accessible tissue: Callus, score: 53.007 | N | N | N | N |
| vg0919039056 | G -> C | LOC_Os09g31522-LOC_Os09g31930 | intergenic_region ; MODIFIER | silent_mutation | Average:28.053; most accessible tissue: Callus, score: 53.007 | N | N | N | N |
| vg0919039056 | G -> A | LOC_Os09g31522.1 | upstream_gene_variant ; 4964.0bp to feature; MODIFIER | silent_mutation | Average:28.053; most accessible tissue: Callus, score: 53.007 | N | N | N | N |
| vg0919039056 | G -> A | LOC_Os09g31930.1 | downstream_gene_variant ; 690.0bp to feature; MODIFIER | silent_mutation | Average:28.053; most accessible tissue: Callus, score: 53.007 | N | N | N | N |
| vg0919039056 | G -> A | LOC_Os09g31522-LOC_Os09g31930 | intergenic_region ; MODIFIER | silent_mutation | Average:28.053; most accessible tissue: Callus, score: 53.007 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0919039056 | NA | 5.23E-06 | mr1057 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0919039056 | NA | 2.99E-06 | mr1565 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0919039056 | NA | 8.60E-06 | mr1613 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0919039056 | 2.09E-08 | 2.09E-08 | mr1024_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0919039056 | NA | 5.31E-08 | mr1038_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0919039056 | NA | 6.60E-07 | mr1057_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0919039056 | 8.75E-06 | 8.75E-06 | mr1389_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0919039056 | NA | 9.29E-08 | mr1565_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0919039056 | NA | 3.02E-06 | mr1613_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0919039056 | NA | 5.12E-06 | mr1913_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0919039056 | NA | 8.38E-06 | mr1922_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0919039056 | 2.11E-07 | 2.11E-07 | mr1940_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |