Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0919017207:

Variant ID: vg0919017207 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 19017207
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:

CGTTGAAGCAAGCGGCGGCGGTAGCGAACTCGTCGTTCCCGGTGGCGGCGGCGTCGATGTCGTCCTTCTCGGCGGCAGCGGCGTCGATGTCGTCCTTCCC[T/C]
GCGGCGGTAGCGGCGGCGACGTTGAAGCAGTCGACGGCAGCAGCGAACTCGTCGTTCCCGGCGGCGGTGGCGGCGTCGATGTCGTCCTTCCCGGAGGCGG

Reverse complement sequence

CCGCCTCCGGGAAGGACGACATCGACGCCGCCACCGCCGCCGGGAACGACGAGTTCGCTGCTGCCGTCGACTGCTTCAACGTCGCCGCCGCTACCGCCGC[A/G]
GGGAAGGACGACATCGACGCCGCTGCCGCCGAGAAGGACGACATCGACGCCGCCGCCACCGGGAACGACGAGTTCGCTACCGCCGCCGCTTGCTTCAACG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	78.10%	19.20%	2.16%	0.55%	NA
All Indica	2759	93.50%	2.50%	3.08%	0.94%	NA
All Japonica	1512	47.60%	52.10%	0.33%	0.00%	NA
Aus	269	91.40%	5.90%	2.60%	0.00%	NA
Indica I	595	96.00%	2.40%	1.68%	0.00%	NA
Indica II	465	84.10%	4.50%	8.39%	3.01%	NA
Indica III	913	97.40%	1.10%	1.20%	0.33%	NA
Indica Intermediate	786	92.70%	2.90%	3.18%	1.15%	NA
Temperate Japonica	767	35.20%	64.30%	0.52%	0.00%	NA
Tropical Japonica	504	65.50%	34.30%	0.20%	0.00%	NA
Japonica Intermediate	241	49.80%	50.20%	0.00%	0.00%	NA
VI/Aromatic	96	90.60%	6.20%	3.12%	0.00%	NA
Intermediate	90	64.40%	33.30%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0919017207	T -> DEL	N	N	silent_mutation	Average:58.409; most accessible tissue: Zhenshan97 flag leaf, score: 82.874	N	N	N	N
vg0919017207	T -> C	LOC_Os09g31502.1	upstream_gene_variant ; 2809.0bp to feature; MODIFIER	silent_mutation	Average:58.409; most accessible tissue: Zhenshan97 flag leaf, score: 82.874	N	N	N	N
vg0919017207	T -> C	LOC_Os09g31502.2	upstream_gene_variant ; 2813.0bp to feature; MODIFIER	silent_mutation	Average:58.409; most accessible tissue: Zhenshan97 flag leaf, score: 82.874	N	N	N	N
vg0919017207	T -> C	LOC_Os09g31502.4	upstream_gene_variant ; 2809.0bp to feature; MODIFIER	silent_mutation	Average:58.409; most accessible tissue: Zhenshan97 flag leaf, score: 82.874	N	N	N	N
vg0919017207	T -> C	LOC_Os09g31514.1	downstream_gene_variant ; 3213.0bp to feature; MODIFIER	silent_mutation	Average:58.409; most accessible tissue: Zhenshan97 flag leaf, score: 82.874	N	N	N	N
vg0919017207	T -> C	LOC_Os09g31514.2	downstream_gene_variant ; 3213.0bp to feature; MODIFIER	silent_mutation	Average:58.409; most accessible tissue: Zhenshan97 flag leaf, score: 82.874	N	N	N	N
vg0919017207	T -> C	LOC_Os09g31514.4	downstream_gene_variant ; 3213.0bp to feature; MODIFIER	silent_mutation	Average:58.409; most accessible tissue: Zhenshan97 flag leaf, score: 82.874	N	N	N	N
vg0919017207	T -> C	LOC_Os09g31514.3	downstream_gene_variant ; 4929.0bp to feature; MODIFIER	silent_mutation	Average:58.409; most accessible tissue: Zhenshan97 flag leaf, score: 82.874	N	N	N	N
vg0919017207	T -> C	LOC_Os09g31506.1	intron_variant ; MODIFIER	silent_mutation	Average:58.409; most accessible tissue: Zhenshan97 flag leaf, score: 82.874	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0919017207	NA	3.33E-15	mr1940	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919017207	NA	7.87E-07	mr1940	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919017207	NA	3.88E-06	mr1100_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919017207	NA	6.06E-08	mr1137_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919017207	5.11E-06	3.73E-23	mr1676_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919017207	NA	3.36E-07	mr1748_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251