\
| Variant ID: vg0918951541 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 18951541 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 350. )
TGTTCTGCATTCAACATGCATGTGTTAGCAGCAATAAAACCGCTCAAATCCGTGCAGGATTCTGCAGAGATTGCCTCAACATGTGCCTCAAGGTACACAA[A/G]
CCAGAATTCAGTTAGCGATCAGTTACTGCCATCCAGAGATCAATTGGATTCATCAGATAATAAGCAGTGCAAGAACAAAATTCTTTTCTCAATAAGATAC
GTATCTTATTGAGAAAAGAATTTTGTTCTTGCACTGCTTATTATCTGATGAATCCAATTGATCTCTGGATGGCAGTAACTGATCGCTAACTGAATTCTGG[T/C]
TTGTGTACCTTGAGGCACATGTTGAGGCAATCTCTGCAGAATCCTGCACGGATTTGAGCGGTTTTATTGCTGCTAACACATGCATGTTGAATGCAGAACA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 87.30% | 12.70% | 0.00% | 0.00% | NA |
| All Indica | 2759 | 98.70% | 1.30% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 64.40% | 35.60% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 98.30% | 1.70% | 0.00% | 0.00% | NA |
| Indica II | 465 | 97.40% | 2.60% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 98.20% | 1.80% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 41.60% | 58.40% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 92.90% | 7.10% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 77.20% | 22.80% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 75.60% | 24.40% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0918951541 | A -> G | LOC_Os09g31450.1 | upstream_gene_variant ; 264.0bp to feature; MODIFIER | silent_mutation | Average:64.923; most accessible tissue: Minghui63 flower, score: 78.614 | N | N | N | N |
| vg0918951541 | A -> G | LOC_Os09g31454.1 | downstream_gene_variant ; 2080.0bp to feature; MODIFIER | silent_mutation | Average:64.923; most accessible tissue: Minghui63 flower, score: 78.614 | N | N | N | N |
| vg0918951541 | A -> G | LOC_Os09g31450-LOC_Os09g31454 | intergenic_region ; MODIFIER | silent_mutation | Average:64.923; most accessible tissue: Minghui63 flower, score: 78.614 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0918951541 | NA | 9.99E-14 | Plant_height | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0918951541 | NA | 1.42E-07 | mr1002 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0918951541 | NA | 1.97E-06 | mr1252 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0918951541 | NA | 5.74E-06 | mr1503 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0918951541 | NA | 2.45E-07 | mr1617 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0918951541 | NA | 9.52E-06 | mr1940 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0918951541 | NA | 5.90E-11 | mr1002_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0918951541 | NA | 9.34E-15 | mr1182_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0918951541 | NA | 5.22E-08 | mr1182_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0918951541 | NA | 6.82E-11 | mr1282_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0918951541 | NA | 5.77E-06 | mr1282_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0918951541 | 3.94E-07 | NA | mr1546_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0918951541 | NA | 2.61E-09 | mr1576_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0918951541 | NA | 7.40E-06 | mr1576_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |