\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0918951541:

Variant ID: vg0918951541 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 18951541
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 350. )

Flanking Sequence (100 bp) in Reference Genome:


TGTTCTGCATTCAACATGCATGTGTTAGCAGCAATAAAACCGCTCAAATCCGTGCAGGATTCTGCAGAGATTGCCTCAACATGTGCCTCAAGGTACACAA[A/G]
CCAGAATTCAGTTAGCGATCAGTTACTGCCATCCAGAGATCAATTGGATTCATCAGATAATAAGCAGTGCAAGAACAAAATTCTTTTCTCAATAAGATAC

Reverse complement sequence

GTATCTTATTGAGAAAAGAATTTTGTTCTTGCACTGCTTATTATCTGATGAATCCAATTGATCTCTGGATGGCAGTAACTGATCGCTAACTGAATTCTGG[T/C]
TTGTGTACCTTGAGGCACATGTTGAGGCAATCTCTGCAGAATCCTGCACGGATTTGAGCGGTTTTATTGCTGCTAACACATGCATGTTGAATGCAGAACA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 87.30% 12.70% 0.00% 0.00% NA
All Indica  2759 98.70% 1.30% 0.00% 0.00% NA
All Japonica  1512 64.40% 35.60% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 98.30% 1.70% 0.00% 0.00% NA
Indica II  465 97.40% 2.60% 0.00% 0.00% NA
Indica III  913 99.90% 0.10% 0.00% 0.00% NA
Indica Intermediate  786 98.20% 1.80% 0.00% 0.00% NA
Temperate Japonica  767 41.60% 58.40% 0.00% 0.00% NA
Tropical Japonica  504 92.90% 7.10% 0.00% 0.00% NA
Japonica Intermediate  241 77.20% 22.80% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 75.60% 24.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0918951541 A -> G LOC_Os09g31450.1 upstream_gene_variant ; 264.0bp to feature; MODIFIER silent_mutation Average:64.923; most accessible tissue: Minghui63 flower, score: 78.614 N N N N
vg0918951541 A -> G LOC_Os09g31454.1 downstream_gene_variant ; 2080.0bp to feature; MODIFIER silent_mutation Average:64.923; most accessible tissue: Minghui63 flower, score: 78.614 N N N N
vg0918951541 A -> G LOC_Os09g31450-LOC_Os09g31454 intergenic_region ; MODIFIER silent_mutation Average:64.923; most accessible tissue: Minghui63 flower, score: 78.614 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0918951541 NA 9.99E-14 Plant_height Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0918951541 NA 1.42E-07 mr1002 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918951541 NA 1.97E-06 mr1252 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918951541 NA 5.74E-06 mr1503 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918951541 NA 2.45E-07 mr1617 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918951541 NA 9.52E-06 mr1940 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918951541 NA 5.90E-11 mr1002_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918951541 NA 9.34E-15 mr1182_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918951541 NA 5.22E-08 mr1182_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918951541 NA 6.82E-11 mr1282_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918951541 NA 5.77E-06 mr1282_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918951541 3.94E-07 NA mr1546_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918951541 NA 2.61E-09 mr1576_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918951541 NA 7.40E-06 mr1576_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251