\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0918931136:

Variant ID: vg0918931136 (JBrowse)Variation Type: INDEL
Chromosome: chr09Position: 18931136
Reference Allele: GTAAlternative Allele: TTA,G
Primary Allele: GTASecondary Allele: TTA

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AAGGGATGTGACCCCTCCTAAGATTATGAATCTGGACTACCCTTTGTCCAGATTCGTTGTTCTAGGAGGGGTCACGTCCCCTCTTAGATTGAGGTTTTTT[GTA/TTA,G]
GAAGGAGGGAGTAGAAGTCAGAAGCAGGAAAACTTAATTTTTTTTCCAGATTCTCAGAAGTTGTTACCAACCAGCTGTTTCTCAGAAATTTAAACTCCCC

Reverse complement sequence

GGGGAGTTTAAATTTCTGAGAAACAGCTGGTTGGTAACAACTTCTGAGAATCTGGAAAAAAAATTAAGTTTTCCTGCTTCTGACTTCTACTCCCTCCTTC[TAC/TAA,C]
AAAAAACCTCAATCTAAGAGGGGACGTGACCCCTCCTAGAACAACGAATCTGGACAAAGGGTAGTCCAGATTCATAATCTTAGGAGGGGTCACATCCCTT

Allele Frequencies:

Populations Population SizeFrequency of GTA(primary allele) Frequency of TTA(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 97.10% 2.70% 0.11% 0.00% G: 0.08%
All Indica  2759 97.80% 2.10% 0.14% 0.00% NA
All Japonica  1512 95.40% 4.30% 0.07% 0.00% G: 0.26%
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 97.00% 2.70% 0.34% 0.00% NA
Indica II  465 99.80% 0.20% 0.00% 0.00% NA
Indica III  913 99.20% 0.70% 0.11% 0.00% NA
Indica Intermediate  786 95.50% 4.30% 0.13% 0.00% NA
Temperate Japonica  767 96.50% 3.50% 0.00% 0.00% NA
Tropical Japonica  504 99.00% 1.00% 0.00% 0.00% NA
Japonica Intermediate  241 84.20% 13.70% 0.41% 0.00% G: 1.66%
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 95.60% 4.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0918931136 GTA -> G LOC_Os09g31438-LOC_Os09g31442 intergenic_region ; MODIFIER silent_mutation Average:59.513; most accessible tissue: Minghui63 panicle, score: 86.012 N N N N
vg0918931136 GTA -> TTA LOC_Os09g31438-LOC_Os09g31442 intergenic_region ; MODIFIER silent_mutation Average:59.513; most accessible tissue: Minghui63 panicle, score: 86.012 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0918931136 GTA G 0.08 0.02 0.02 0.0 -0.02 -0.06
vg0918931136 GTA TTA 0.07 0.01 0.01 0.01 0.03 0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0918931136 3.16E-06 4.00E-09 mr1231 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918931136 4.84E-06 6.58E-13 mr1232 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918931136 1.25E-08 6.83E-09 mr1232 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918931136 NA 3.44E-06 mr1496 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918931136 3.82E-14 5.07E-31 mr1557 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918931136 1.23E-13 1.21E-19 mr1557 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918931136 1.06E-08 NA mr1598 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918931136 1.83E-07 1.79E-12 mr1598 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918931136 6.50E-06 1.47E-08 mr1944 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918931136 2.20E-07 5.45E-10 mr1113_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918931136 NA 6.38E-06 mr1114_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918931136 NA 8.77E-07 mr1117_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918931136 NA 1.84E-07 mr1118_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918931136 NA 7.44E-08 mr1119_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918931136 NA 1.30E-07 mr1120_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918931136 NA 9.05E-07 mr1123_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918931136 NA 1.14E-09 mr1170_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918931136 NA 1.74E-08 mr1240_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918931136 NA 7.65E-07 mr1247_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918931136 NA 1.82E-07 mr1496_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918931136 2.03E-06 2.36E-19 mr1557_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918931136 5.71E-09 4.13E-13 mr1557_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918931136 8.78E-07 NA mr1598_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918931136 7.39E-08 2.84E-14 mr1598_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918931136 NA 1.14E-09 mr1974_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918931136 NA 1.97E-06 mr1974_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251