\
| Variant ID: vg0918927566 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr09 | Position: 18927566 |
| Reference Allele: T | Alternative Allele: C,TAA |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.01, others allele: 0.00, population size: 97. )
AAGATATTGCATGTGGGTTATAAATGCTTGTGAGCATGGATGCATGTATCAATGTCTATTTACTCCAATGCACAAATAACGAATAGACTTAATAAATAAA[T/C,TAA]
ATAAATATGTAGATCAATTTAGAATTAAGAGAGTATAATTAAGTAACGTAGAGAAACAAGGCCCTAGAGAGTTTCTGGCAGCTTTACTCTGAGAATAATT
AATTATTCTCAGAGTAAAGCTGCCAGAAACTCTCTAGGGCCTTGTTTCTCTACGTTACTTAATTATACTCTCTTAATTCTAAATTGATCTACATATTTAT[A/G,TTA]
TTTATTTATTAAGTCTATTCGTTATTTGTGCATTGGAGTAAATAGACATTGATACATGCATCCATGCTCACAAGCATTTATAACCCACATGCAATATCTT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 75.00% | 23.40% | 1.48% | 0.00% | TAA: 0.11% |
| All Indica | 2759 | 97.00% | 2.90% | 0.07% | 0.00% | NA |
| All Japonica | 1512 | 38.90% | 56.80% | 4.30% | 0.00% | NA |
| Aus | 269 | 79.20% | 18.60% | 0.37% | 0.00% | TAA: 1.86% |
| Indica I | 595 | 98.20% | 1.80% | 0.00% | 0.00% | NA |
| Indica II | 465 | 96.30% | 3.70% | 0.00% | 0.00% | NA |
| Indica III | 913 | 97.20% | 2.80% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 96.30% | 3.40% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 19.70% | 75.50% | 4.82% | 0.00% | NA |
| Tropical Japonica | 504 | 65.50% | 31.20% | 3.37% | 0.00% | NA |
| Japonica Intermediate | 241 | 44.40% | 51.00% | 4.56% | 0.00% | NA |
| VI/Aromatic | 96 | 15.60% | 84.40% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 60.00% | 37.80% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0918927566 | T -> C | LOC_Os09g31438-LOC_Os09g31442 | intergenic_region ; MODIFIER | silent_mutation | Average:45.074; most accessible tissue: Zhenshan97 panicle, score: 72.468 | N | N | N | N |
| vg0918927566 | T -> TAA | LOC_Os09g31438-LOC_Os09g31442 | intergenic_region ; MODIFIER | silent_mutation | Average:45.074; most accessible tissue: Zhenshan97 panicle, score: 72.468 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0918927566 | 6.42E-06 | NA | mr1023 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0918927566 | 1.31E-06 | NA | mr1079 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0918927566 | 1.62E-07 | NA | mr1142 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0918927566 | 3.97E-06 | NA | mr1178 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0918927566 | 8.56E-09 | NA | mr1489 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0918927566 | 7.00E-07 | NA | mr1491 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0918927566 | NA | 1.99E-06 | mr1677 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0918927566 | 4.68E-08 | NA | mr1778 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0918927566 | 2.19E-06 | NA | mr1023_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0918927566 | 5.20E-06 | NA | mr1057_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0918927566 | NA | 6.79E-10 | mr1057_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0918927566 | NA | 1.31E-06 | mr1182_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0918927566 | 1.46E-07 | NA | mr1489_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0918927566 | 2.06E-06 | NA | mr1778_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0918927566 | NA | 2.72E-08 | mr1905_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0918927566 | NA | 1.74E-06 | mr1980_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |