\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0918922771:

Variant ID: vg0918922771 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 18922771
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.02, others allele: 0.00, population size: 113. )

Flanking Sequence (100 bp) in Reference Genome:


AAATTGGAGCTAGTAGTTGGCTATACTATTAAACTTGCTCTAATTAGTACTCCCTCCGTCCCGTAATATAAGAGATTTTAATATTTTATTTACACTGTTT[G/A]
ATCACTCGTCTTATTAAAAAATTTATGCAGATATAAAAAAAGTTATACATAAAATACTTTAGATAATAAAGTAAATTATAAAAAATAAATAATAATTTTA

Reverse complement sequence

TAAAATTATTATTTATTTTTTATAATTTACTTTATTATCTAAAGTATTTTATGTATAACTTTTTTTATATCTGCATAAATTTTTTAATAAGACGAGTGAT[C/T]
AAACAGTGTAAATAAAATATTAAAATCTCTTATATTACGGGACGGAGGGAGTACTAATTAGAGCAAGTTTAATAGTATAGCCAACTACTAGCTCCAATTT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 61.00% 38.70% 0.30% 0.00% NA
All Indica  2759 34.20% 65.30% 0.43% 0.00% NA
All Japonica  1512 99.80% 0.20% 0.00% 0.00% NA
Aus  269 95.90% 3.70% 0.37% 0.00% NA
Indica I  595 17.00% 82.70% 0.34% 0.00% NA
Indica II  465 71.60% 28.00% 0.43% 0.00% NA
Indica III  913 20.70% 79.00% 0.33% 0.00% NA
Indica Intermediate  786 40.80% 58.50% 0.64% 0.00% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 99.80% 0.20% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 86.70% 12.20% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0918922771 G -> A LOC_Os09g31434.1 upstream_gene_variant ; 4730.0bp to feature; MODIFIER silent_mutation Average:82.551; most accessible tissue: Zhenshan97 panicle, score: 95.081 N N N N
vg0918922771 G -> A LOC_Os09g31438.1 upstream_gene_variant ; 1115.0bp to feature; MODIFIER silent_mutation Average:82.551; most accessible tissue: Zhenshan97 panicle, score: 95.081 N N N N
vg0918922771 G -> A LOC_Os09g31438-LOC_Os09g31442 intergenic_region ; MODIFIER silent_mutation Average:82.551; most accessible tissue: Zhenshan97 panicle, score: 95.081 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0918922771 G A 0.01 0.03 0.01 0.02 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0918922771 8.78E-06 NA mr1105 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918922771 9.54E-09 2.76E-14 mr1231 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918922771 1.32E-08 1.14E-12 mr1231 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918922771 1.04E-10 NA mr1232 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918922771 1.28E-10 2.06E-11 mr1232 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918922771 8.14E-23 NA mr1557 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918922771 1.03E-22 1.53E-33 mr1557 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918922771 1.27E-20 1.36E-46 mr1598 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918922771 9.53E-16 3.52E-23 mr1598 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918922771 NA 5.94E-08 mr1610 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918922771 2.00E-09 NA mr1944 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918922771 9.20E-10 1.09E-13 mr1944 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918922771 NA 2.36E-09 mr1050_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918922771 NA 7.02E-08 mr1232_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918922771 NA 7.76E-06 mr1233_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918922771 NA 1.38E-06 mr1272_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918922771 NA 2.83E-19 mr1531_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918922771 NA 3.66E-07 mr1531_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918922771 7.46E-16 NA mr1557_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918922771 2.19E-15 3.73E-25 mr1557_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918922771 1.73E-18 3.54E-67 mr1598_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918922771 3.81E-15 9.63E-29 mr1598_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251