Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0918912379:

Variant ID: vg0918912379 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 18912379
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.88, C: 0.12, others allele: 0.00, population size: 107. )

Flanking Sequence (100 bp) in Reference Genome:

AGAGATAGTGGTCGTGTCCGGTATGGACATATCTTATAATTCTCGGGTATAAATAGACCCCGAGCCCTATGTAATTTTGAACACACACGTTCAATACAAT[C/T]
TCGGCGCATCGCCACCTTTTTGCTTTAGTTTTGTTTCGACGAGTTCTTGCTTTCGGGTTGAGCTGCATCGGTTTCGATCTTCAACAAGAGGTAAAACTTG

Reverse complement sequence

CAAGTTTTACCTCTTGTTGAAGATCGAAACCGATGCAGCTCAACCCGAAAGCAAGAACTCGTCGAAACAAAACTAAAGCAAAAAGGTGGCGATGCGCCGA[G/A]
ATTGTATTGAACGTGTGTGTTCAAAATTACATAGGGCTCGGGGTCTATTTATACCCGAGAATTATAAGATATGTCCATACCGGACACGACCACTATCTCT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	60.70%	3.60%	35.48%	0.21%	NA
All Indica	2759	38.10%	5.80%	55.82%	0.36%	NA
All Japonica	1512	99.90%	0.00%	0.13%	0.00%	NA
Aus	269	53.50%	2.20%	44.24%	0.00%	NA
Indica I	595	22.00%	6.20%	70.59%	1.18%	NA
Indica II	465	51.20%	5.40%	43.44%	0.00%	NA
Indica III	913	39.80%	5.90%	54.11%	0.22%	NA
Indica Intermediate	786	40.50%	5.50%	53.94%	0.13%	NA
Temperate Japonica	767	99.90%	0.00%	0.13%	0.00%	NA
Tropical Japonica	504	99.80%	0.00%	0.20%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	95.80%	1.00%	3.12%	0.00%	NA
Intermediate	90	81.10%	4.40%	14.44%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0918912379	C -> DEL	N	N	silent_mutation	Average:23.406; most accessible tissue: Zhenshan97 panicle, score: 54.901	N	N	N	N
vg0918912379	C -> T	LOC_Os09g31430.1	upstream_gene_variant ; 3952.0bp to feature; MODIFIER	silent_mutation	Average:23.406; most accessible tissue: Zhenshan97 panicle, score: 54.901	N	N	N	N
vg0918912379	C -> T	LOC_Os09g31430.2	upstream_gene_variant ; 3952.0bp to feature; MODIFIER	silent_mutation	Average:23.406; most accessible tissue: Zhenshan97 panicle, score: 54.901	N	N	N	N
vg0918912379	C -> T	LOC_Os09g31434.1	downstream_gene_variant ; 4919.0bp to feature; MODIFIER	silent_mutation	Average:23.406; most accessible tissue: Zhenshan97 panicle, score: 54.901	N	N	N	N
vg0918912379	C -> T	LOC_Os09g31430-LOC_Os09g31434	intergenic_region ; MODIFIER	silent_mutation	Average:23.406; most accessible tissue: Zhenshan97 panicle, score: 54.901	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0918912379	NA	4.62E-06	mr1205_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918912379	6.93E-06	9.69E-07	mr1304_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918912379	NA	5.46E-06	mr1329_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918912379	NA	5.29E-06	mr1376_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918912379	5.11E-06	9.65E-07	mr1422_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918912379	5.80E-06	5.80E-06	mr1424_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918912379	NA	7.48E-06	mr1431_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918912379	8.85E-06	1.88E-06	mr1505_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918912379	NA	6.94E-06	mr1524_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918912379	NA	6.92E-06	mr1580_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918912379	NA	1.35E-06	mr1754_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918912379	NA	3.58E-07	mr1819_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918912379	NA	2.16E-06	mr1825_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918912379	NA	7.59E-06	mr1854_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918912379	1.69E-07	1.69E-07	mr1884_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918912379	1.29E-06	3.95E-07	mr1901_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251