\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0918912379:

Variant ID: vg0918912379 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 18912379
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.88, C: 0.12, others allele: 0.00, population size: 107. )

Flanking Sequence (100 bp) in Reference Genome:


AGAGATAGTGGTCGTGTCCGGTATGGACATATCTTATAATTCTCGGGTATAAATAGACCCCGAGCCCTATGTAATTTTGAACACACACGTTCAATACAAT[C/T]
TCGGCGCATCGCCACCTTTTTGCTTTAGTTTTGTTTCGACGAGTTCTTGCTTTCGGGTTGAGCTGCATCGGTTTCGATCTTCAACAAGAGGTAAAACTTG

Reverse complement sequence

CAAGTTTTACCTCTTGTTGAAGATCGAAACCGATGCAGCTCAACCCGAAAGCAAGAACTCGTCGAAACAAAACTAAAGCAAAAAGGTGGCGATGCGCCGA[G/A]
ATTGTATTGAACGTGTGTGTTCAAAATTACATAGGGCTCGGGGTCTATTTATACCCGAGAATTATAAGATATGTCCATACCGGACACGACCACTATCTCT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 60.70% 3.60% 35.48% 0.21% NA
All Indica  2759 38.10% 5.80% 55.82% 0.36% NA
All Japonica  1512 99.90% 0.00% 0.13% 0.00% NA
Aus  269 53.50% 2.20% 44.24% 0.00% NA
Indica I  595 22.00% 6.20% 70.59% 1.18% NA
Indica II  465 51.20% 5.40% 43.44% 0.00% NA
Indica III  913 39.80% 5.90% 54.11% 0.22% NA
Indica Intermediate  786 40.50% 5.50% 53.94% 0.13% NA
Temperate Japonica  767 99.90% 0.00% 0.13% 0.00% NA
Tropical Japonica  504 99.80% 0.00% 0.20% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 95.80% 1.00% 3.12% 0.00% NA
Intermediate  90 81.10% 4.40% 14.44% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0918912379 C -> DEL N N silent_mutation Average:23.406; most accessible tissue: Zhenshan97 panicle, score: 54.901 N N N N
vg0918912379 C -> T LOC_Os09g31430.1 upstream_gene_variant ; 3952.0bp to feature; MODIFIER silent_mutation Average:23.406; most accessible tissue: Zhenshan97 panicle, score: 54.901 N N N N
vg0918912379 C -> T LOC_Os09g31430.2 upstream_gene_variant ; 3952.0bp to feature; MODIFIER silent_mutation Average:23.406; most accessible tissue: Zhenshan97 panicle, score: 54.901 N N N N
vg0918912379 C -> T LOC_Os09g31434.1 downstream_gene_variant ; 4919.0bp to feature; MODIFIER silent_mutation Average:23.406; most accessible tissue: Zhenshan97 panicle, score: 54.901 N N N N
vg0918912379 C -> T LOC_Os09g31430-LOC_Os09g31434 intergenic_region ; MODIFIER silent_mutation Average:23.406; most accessible tissue: Zhenshan97 panicle, score: 54.901 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0918912379 NA 4.62E-06 mr1205_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918912379 6.93E-06 9.69E-07 mr1304_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918912379 NA 5.46E-06 mr1329_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918912379 NA 5.29E-06 mr1376_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918912379 5.11E-06 9.65E-07 mr1422_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918912379 5.80E-06 5.80E-06 mr1424_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918912379 NA 7.48E-06 mr1431_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918912379 8.85E-06 1.88E-06 mr1505_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918912379 NA 6.94E-06 mr1524_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918912379 NA 6.92E-06 mr1580_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918912379 NA 1.35E-06 mr1754_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918912379 NA 3.58E-07 mr1819_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918912379 NA 2.16E-06 mr1825_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918912379 NA 7.59E-06 mr1854_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918912379 1.69E-07 1.69E-07 mr1884_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918912379 1.29E-06 3.95E-07 mr1901_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251