\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0918912349:

Variant ID: vg0918912349 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 18912349
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.02, others allele: 0.00, population size: 116. )

Flanking Sequence (100 bp) in Reference Genome:


GCAAAGACTTATGGTATCTTAGAGTTTGTTAGAGATAGTGGTCGTGTCCGGTATGGACATATCTTATAATTCTCGGGTATAAATAGACCCCGAGCCCTAT[G/A]
TAATTTTGAACACACACGTTCAATACAATCTCGGCGCATCGCCACCTTTTTGCTTTAGTTTTGTTTCGACGAGTTCTTGCTTTCGGGTTGAGCTGCATCG

Reverse complement sequence

CGATGCAGCTCAACCCGAAAGCAAGAACTCGTCGAAACAAAACTAAAGCAAAAAGGTGGCGATGCGCCGAGATTGTATTGAACGTGTGTGTTCAAAATTA[C/T]
ATAGGGCTCGGGGTCTATTTATACCCGAGAATTATAAGATATGTCCATACCGGACACGACCACTATCTCTAACAAACTCTAAGATACCATAAGTCTTTGC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 51.60% 48.30% 0.06% 0.00% NA
All Indica  2759 87.00% 12.90% 0.11% 0.00% NA
All Japonica  1512 0.10% 99.90% 0.00% 0.00% NA
Aus  269 5.60% 94.40% 0.00% 0.00% NA
Indica I  595 86.10% 13.90% 0.00% 0.00% NA
Indica II  465 93.50% 6.50% 0.00% 0.00% NA
Indica III  913 87.60% 12.20% 0.22% 0.00% NA
Indica Intermediate  786 83.10% 16.80% 0.13% 0.00% NA
Temperate Japonica  767 0.10% 99.90% 0.00% 0.00% NA
Tropical Japonica  504 0.20% 99.80% 0.00% 0.00% NA
Japonica Intermediate  241 0.00% 100.00% 0.00% 0.00% NA
VI/Aromatic  96 1.00% 99.00% 0.00% 0.00% NA
Intermediate  90 23.30% 76.70% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0918912349 G -> A LOC_Os09g31430.1 upstream_gene_variant ; 3922.0bp to feature; MODIFIER silent_mutation Average:23.027; most accessible tissue: Zhenshan97 panicle, score: 57.341 N N N N
vg0918912349 G -> A LOC_Os09g31430.2 upstream_gene_variant ; 3922.0bp to feature; MODIFIER silent_mutation Average:23.027; most accessible tissue: Zhenshan97 panicle, score: 57.341 N N N N
vg0918912349 G -> A LOC_Os09g31434.1 downstream_gene_variant ; 4949.0bp to feature; MODIFIER silent_mutation Average:23.027; most accessible tissue: Zhenshan97 panicle, score: 57.341 N N N N
vg0918912349 G -> A LOC_Os09g31430-LOC_Os09g31434 intergenic_region ; MODIFIER silent_mutation Average:23.027; most accessible tissue: Zhenshan97 panicle, score: 57.341 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0918912349 NA 8.40E-59 mr1088 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918912349 NA 1.29E-09 mr1151 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918912349 NA 1.46E-15 mr1199 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918912349 NA 7.58E-31 mr1224 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918912349 NA 3.50E-31 mr1225 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918912349 NA 2.79E-66 mr1246 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918912349 NA 1.13E-07 mr1246 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918912349 NA 1.72E-08 mr1249 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918912349 NA 3.79E-34 mr1404 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918912349 NA 1.67E-08 mr1559 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918912349 NA 1.44E-29 mr1560 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918912349 3.85E-06 1.17E-21 mr1598 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918912349 NA 4.55E-11 mr1657 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918912349 NA 2.89E-07 mr1707 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918912349 NA 4.41E-32 mr1878 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918912349 NA 9.55E-09 mr1172_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918912349 NA 5.06E-38 mr1224_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918912349 NA 2.98E-76 mr1246_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918912349 NA 2.60E-11 mr1246_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918912349 NA 7.80E-07 mr1559_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918912349 2.78E-07 5.65E-37 mr1598_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251