Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0918902466:

Variant ID: vg0918902466 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 18902466
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ATTAAACGTAGTCTAATAACAAAATAAAATTACAGATTCCGACAGGAAACCGCGAGACGAATTTATTAAGCCTAATTAATCTACCATTAGCAAATGTTTA[C/T]
TGTAGCACCATAATATCAAATCATGGTGTAATTAGGCTTAAAAAATTTGTCTCGTAATTTCCTGGCGAATTGTGTAATTAATCTTTTTTTCTACATTTAA

Reverse complement sequence

TTAAATGTAGAAAAAAAGATTAATTACACAATTCGCCAGGAAATTACGAGACAAATTTTTTAAGCCTAATTACACCATGATTTGATATTATGGTGCTACA[G/A]
TAAACATTTGCTAATGGTAGATTAATTAGGCTTAATAAATTCGTCTCGCGGTTTCCTGTCGGAATCTGTAATTTTATTTTGTTATTAGACTACGTTTAAT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	86.40%	13.00%	0.61%	0.00%	NA
All Indica	2759	99.00%	1.00%	0.00%	0.00%	NA
All Japonica	1512	61.20%	36.90%	1.85%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	99.80%	0.20%	0.00%	0.00%	NA
Indica III	913	97.70%	2.30%	0.00%	0.00%	NA
Indica Intermediate	786	99.20%	0.80%	0.00%	0.00%	NA
Temperate Japonica	767	96.60%	1.40%	1.96%	0.00%	NA
Tropical Japonica	504	10.50%	87.70%	1.79%	0.00%	NA
Japonica Intermediate	241	54.80%	43.60%	1.66%	0.00%	NA
VI/Aromatic	96	85.40%	14.60%	0.00%	0.00%	NA
Intermediate	90	82.20%	16.70%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0918902466	C -> T	LOC_Os09g31420.1	downstream_gene_variant ; 317.0bp to feature; MODIFIER	silent_mutation	Average:34.516; most accessible tissue: Zhenshan97 panicle, score: 71.253	N	N	N	N
vg0918902466	C -> T	LOC_Os09g31430.1	downstream_gene_variant ; 2858.0bp to feature; MODIFIER	silent_mutation	Average:34.516; most accessible tissue: Zhenshan97 panicle, score: 71.253	N	N	N	N
vg0918902466	C -> T	LOC_Os09g31430.2	downstream_gene_variant ; 2858.0bp to feature; MODIFIER	silent_mutation	Average:34.516; most accessible tissue: Zhenshan97 panicle, score: 71.253	N	N	N	N
vg0918902466	C -> T	LOC_Os09g31410-LOC_Os09g31420	intergenic_region ; MODIFIER	silent_mutation	Average:34.516; most accessible tissue: Zhenshan97 panicle, score: 71.253	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0918902466	NA	4.50E-06	mr1077	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918902466	NA	1.95E-06	mr1277	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918902466	NA	1.27E-06	mr1338	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918902466	NA	6.61E-06	mr1405	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918902466	NA	2.20E-13	mr1449	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918902466	NA	4.66E-09	mr1539	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918902466	NA	2.27E-08	mr1552	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918902466	NA	2.40E-06	mr1627	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918902466	NA	2.62E-07	mr1723	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918902466	NA	1.79E-12	mr1871	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918902466	NA	1.39E-07	mr1156_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918902466	NA	9.89E-10	mr1338_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918902466	NA	5.03E-06	mr1397_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918902466	NA	2.98E-06	mr1428_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918902466	NA	2.90E-08	mr1449_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918902466	NA	4.93E-14	mr1742_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918902466	NA	7.23E-10	mr1851_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918902466	NA	6.18E-13	mr1864_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918902466	NA	1.85E-06	mr1966_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251