\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0918902466:

Variant ID: vg0918902466 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 18902466
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATTAAACGTAGTCTAATAACAAAATAAAATTACAGATTCCGACAGGAAACCGCGAGACGAATTTATTAAGCCTAATTAATCTACCATTAGCAAATGTTTA[C/T]
TGTAGCACCATAATATCAAATCATGGTGTAATTAGGCTTAAAAAATTTGTCTCGTAATTTCCTGGCGAATTGTGTAATTAATCTTTTTTTCTACATTTAA

Reverse complement sequence

TTAAATGTAGAAAAAAAGATTAATTACACAATTCGCCAGGAAATTACGAGACAAATTTTTTAAGCCTAATTACACCATGATTTGATATTATGGTGCTACA[G/A]
TAAACATTTGCTAATGGTAGATTAATTAGGCTTAATAAATTCGTCTCGCGGTTTCCTGTCGGAATCTGTAATTTTATTTTGTTATTAGACTACGTTTAAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 86.40% 13.00% 0.61% 0.00% NA
All Indica  2759 99.00% 1.00% 0.00% 0.00% NA
All Japonica  1512 61.20% 36.90% 1.85% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.80% 0.20% 0.00% 0.00% NA
Indica III  913 97.70% 2.30% 0.00% 0.00% NA
Indica Intermediate  786 99.20% 0.80% 0.00% 0.00% NA
Temperate Japonica  767 96.60% 1.40% 1.96% 0.00% NA
Tropical Japonica  504 10.50% 87.70% 1.79% 0.00% NA
Japonica Intermediate  241 54.80% 43.60% 1.66% 0.00% NA
VI/Aromatic  96 85.40% 14.60% 0.00% 0.00% NA
Intermediate  90 82.20% 16.70% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0918902466 C -> T LOC_Os09g31420.1 downstream_gene_variant ; 317.0bp to feature; MODIFIER silent_mutation Average:34.516; most accessible tissue: Zhenshan97 panicle, score: 71.253 N N N N
vg0918902466 C -> T LOC_Os09g31430.1 downstream_gene_variant ; 2858.0bp to feature; MODIFIER silent_mutation Average:34.516; most accessible tissue: Zhenshan97 panicle, score: 71.253 N N N N
vg0918902466 C -> T LOC_Os09g31430.2 downstream_gene_variant ; 2858.0bp to feature; MODIFIER silent_mutation Average:34.516; most accessible tissue: Zhenshan97 panicle, score: 71.253 N N N N
vg0918902466 C -> T LOC_Os09g31410-LOC_Os09g31420 intergenic_region ; MODIFIER silent_mutation Average:34.516; most accessible tissue: Zhenshan97 panicle, score: 71.253 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0918902466 NA 4.50E-06 mr1077 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918902466 NA 1.95E-06 mr1277 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918902466 NA 1.27E-06 mr1338 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918902466 NA 6.61E-06 mr1405 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918902466 NA 2.20E-13 mr1449 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918902466 NA 4.66E-09 mr1539 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918902466 NA 2.27E-08 mr1552 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918902466 NA 2.40E-06 mr1627 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918902466 NA 2.62E-07 mr1723 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918902466 NA 1.79E-12 mr1871 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918902466 NA 1.39E-07 mr1156_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918902466 NA 9.89E-10 mr1338_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918902466 NA 5.03E-06 mr1397_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918902466 NA 2.98E-06 mr1428_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918902466 NA 2.90E-08 mr1449_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918902466 NA 4.93E-14 mr1742_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918902466 NA 7.23E-10 mr1851_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918902466 NA 6.18E-13 mr1864_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918902466 NA 1.85E-06 mr1966_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251