\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0918886513:

Variant ID: vg0918886513 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 18886513
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, others allele: 0.00, population size: 122. )

Flanking Sequence (100 bp) in Reference Genome:


GGGAGCAGGGGTAGGGAAGGAAAGAAAGAAAGGCTCGCAGATCCCATTTGCTCCGGTCCACTCTGTGCACAGCCCTGTGTTGTCTAGGACTACCTCCGTC[T/C]
CAAAATAAGTGCGGTCATGGAAATCTGTTTTCAACATTTGACCGTTCGTCTTATTTGAAAAATTTATGAAATTTTTTTAAAAAAATAGTCACACATAAAG

Reverse complement sequence

CTTTATGTGTGACTATTTTTTTAAAAAAATTTCATAAATTTTTCAAATAAGACGAACGGTCAAATGTTGAAAACAGATTTCCATGACCGCACTTATTTTG[A/G]
GACGGAGGTAGTCCTAGACAACACAGGGCTGTGCACAGAGTGGACCGGAGCAAATGGGATCTGCGAGCCTTTCTTTCTTTCCTTCCCTACCCCTGCTCCC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 80.70% 14.60% 2.62% 1.99% NA
All Indica  2759 92.70% 1.60% 2.25% 3.41% NA
All Japonica  1512 55.00% 41.20% 3.84% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 95.10% 1.80% 2.52% 0.50% NA
Indica II  465 87.50% 3.20% 1.94% 7.31% NA
Indica III  913 94.90% 0.00% 1.53% 3.61% NA
Indica Intermediate  786 91.50% 2.40% 3.05% 3.05% NA
Temperate Japonica  767 25.70% 69.90% 4.43% 0.00% NA
Tropical Japonica  504 89.90% 7.90% 2.18% 0.00% NA
Japonica Intermediate  241 75.10% 19.50% 5.39% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 68.90% 26.70% 4.44% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0918886513 T -> DEL N N silent_mutation Average:97.0; most accessible tissue: Callus, score: 99.248 N N N N
vg0918886513 T -> C LOC_Os09g31400.1 upstream_gene_variant ; 126.0bp to feature; MODIFIER silent_mutation Average:97.0; most accessible tissue: Callus, score: 99.248 N N N N
vg0918886513 T -> C LOC_Os09g31410.2 downstream_gene_variant ; 3208.0bp to feature; MODIFIER silent_mutation Average:97.0; most accessible tissue: Callus, score: 99.248 N N N N
vg0918886513 T -> C LOC_Os09g31410.1 downstream_gene_variant ; 3208.0bp to feature; MODIFIER silent_mutation Average:97.0; most accessible tissue: Callus, score: 99.248 N N N N
vg0918886513 T -> C LOC_Os09g31400-LOC_Os09g31410 intergenic_region ; MODIFIER silent_mutation Average:97.0; most accessible tissue: Callus, score: 99.248 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0918886513 T C 0.01 0.06 0.04 0.03 0.02 0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0918886513 NA 5.51E-07 mr1002 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918886513 NA 1.13E-14 mr1182 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918886513 NA 1.91E-07 mr1182 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918886513 NA 9.19E-07 mr1183 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918886513 NA 6.10E-12 mr1282 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918886513 NA 4.05E-06 mr1282 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918886513 NA 2.05E-07 mr1503 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918886513 1.45E-07 NA mr1518 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918886513 NA 1.10E-13 mr1650 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918886513 NA 5.82E-06 mr1650 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918886513 NA 3.60E-10 mr1658 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918886513 3.94E-08 NA mr1676 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918886513 NA 2.78E-06 mr1677 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918886513 NA 4.31E-09 mr1002_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918886513 NA 2.57E-07 mr1057_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918886513 NA 1.47E-14 mr1182_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918886513 NA 1.57E-07 mr1182_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918886513 NA 1.12E-10 mr1282_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918886513 NA 9.47E-06 mr1282_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918886513 NA 1.18E-09 mr1530_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918886513 NA 5.75E-08 mr1576_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918886513 NA 8.66E-06 mr1648_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918886513 NA 7.97E-06 mr1655_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918886513 8.79E-09 NA mr1676_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918886513 NA 4.57E-07 mr1730_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918886513 NA 2.12E-06 mr1861_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251