\
| Variant ID: vg0918882956 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr09 | Position: 18882956 |
| Reference Allele: T | Alternative Allele: A,TA,TAAA,TAAAA,TAA |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.83, T: 0.18, others allele: 0.00, population size: 91. )
AACATTAGTTGTTTTTAGTTTTTTAGGTAAGAGAACTACAGAAGACACTCCATGGCTCTTATTCAGCGTATAAACGCTTTCTTGGACTTCTTTTTTTTTT[T/A,TA,TAAA,TAAAA,TAA]
AAAAAAAAAGCAAGCAGGATTGCAAACAGATTCTACAAATTGGAAAATGTACCAGTCATACAAAATGTCCAGCAGGACAAGCTATCATAGTATCATACAG
CTGTATGATACTATGATAGCTTGTCCTGCTGGACATTTTGTATGACTGGTACATTTTCCAATTTGTAGAATCTGTTTGCAATCCTGCTTGCTTTTTTTTT[A/T,TA,TTTA,TTTTA,TTA]
AAAAAAAAAAGAAGTCCAAGAAAGCGTTTATACGCTGAATAAGAGCCATGGAGTGTCTTCTGTAGTTCTCTTACCTAAAAAACTAAAAACAACTAATGTT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 66.00% | 27.30% | 1.97% | 0.00% | TA: 3.60%; TAAAA: 0.76%; TAAA: 0.40%; TAA: 0.02% |
| All Indica | 2759 | 90.80% | 3.10% | 0.62% | 0.00% | TA: 4.78%; TAAA: 0.69% |
| All Japonica | 1512 | 18.00% | 75.00% | 4.63% | 0.00% | TAAAA: 2.12%; TA: 0.20%; TAA: 0.07% |
| Aus | 269 | 82.20% | 5.60% | 0.74% | 0.00% | TA: 11.15%; TAAAA: 0.37% |
| Indica I | 595 | 87.70% | 1.80% | 2.02% | 0.00% | TA: 8.24%; TAAA: 0.17% |
| Indica II | 465 | 96.10% | 3.40% | 0.00% | 0.00% | TA: 0.43% |
| Indica III | 913 | 92.90% | 2.80% | 0.33% | 0.00% | TA: 2.63%; TAAA: 1.31% |
| Indica Intermediate | 786 | 87.70% | 4.10% | 0.25% | 0.00% | TA: 7.25%; TAAA: 0.76% |
| Temperate Japonica | 767 | 18.10% | 75.00% | 5.61% | 0.00% | TAAAA: 1.17%; TAA: 0.13% |
| Tropical Japonica | 504 | 15.90% | 79.20% | 3.37% | 0.00% | TAAAA: 0.99%; TA: 0.60% |
| Japonica Intermediate | 241 | 22.00% | 66.40% | 4.15% | 0.00% | TAAAA: 7.47% |
| VI/Aromatic | 96 | 83.30% | 16.70% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 43.30% | 43.30% | 4.44% | 0.00% | TA: 5.56%; TAAAA: 3.33% |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0918882956 | T -> TAA | LOC_Os09g31400.1 | 3_prime_UTR_variant ; 1052.0bp to feature; MODIFIER | silent_mutation | Average:56.166; most accessible tissue: Minghui63 root, score: 70.332 | N | N | N | N |
| vg0918882956 | T -> TAAAA | LOC_Os09g31400.1 | 3_prime_UTR_variant ; 1052.0bp to feature; MODIFIER | silent_mutation | Average:56.166; most accessible tissue: Minghui63 root, score: 70.332 | N | N | N | N |
| vg0918882956 | T -> A | LOC_Os09g31400.1 | 3_prime_UTR_variant ; 1053.0bp to feature; MODIFIER | silent_mutation | Average:56.166; most accessible tissue: Minghui63 root, score: 70.332 | N | N | N | N |
| vg0918882956 | T -> TAAA | LOC_Os09g31400.1 | 3_prime_UTR_variant ; 1052.0bp to feature; MODIFIER | silent_mutation | Average:56.166; most accessible tissue: Minghui63 root, score: 70.332 | N | N | N | N |
| vg0918882956 | T -> TA | LOC_Os09g31400.1 | 3_prime_UTR_variant ; 1052.0bp to feature; MODIFIER | silent_mutation | Average:56.166; most accessible tissue: Minghui63 root, score: 70.332 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0918882956 | NA | 3.86E-08 | mr1246 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0918882956 | NA | 6.00E-06 | mr1246 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0918882956 | NA | 6.93E-06 | mr1404 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0918882956 | 1.34E-06 | 7.11E-07 | mr1517 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0918882956 | 4.84E-06 | 1.80E-07 | mr1538 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0918882956 | NA | 3.41E-19 | mr1598 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0918882956 | NA | 9.38E-11 | mr1246_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0918882956 | NA | 1.82E-07 | mr1399_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |