\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0918877233:

Variant ID: vg0918877233 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 18877233
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 340. )

Flanking Sequence (100 bp) in Reference Genome:


CCGAAACATACACAGAGAAGGCAAGGTAGCAAGCTATATACGTATGCGTATGTGCCTCTATCTATCTATAGCCATAGCTGCAAGGTCCTAAATACTCTTT[G/A]
ACTCTATGAGGCTAGCAGCCAAGGCGCCACCTCTCTCTCTCTCACTCACTTTCTCTCTTCCTCTTCCACACCAGCAACTACCCCATGCATGACCTCTAGC

Reverse complement sequence

GCTAGAGGTCATGCATGGGGTAGTTGCTGGTGTGGAAGAGGAAGAGAGAAAGTGAGTGAGAGAGAGAGAGGTGGCGCCTTGGCTGCTAGCCTCATAGAGT[C/T]
AAAGAGTATTTAGGACCTTGCAGCTATGGCTATAGATAGATAGAGGCACATACGCATACGTATATAGCTTGCTACCTTGCCTTCTCTGTGTATGTTTCGG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 95.80% 3.30% 0.89% 0.00% NA
All Indica  2759 92.90% 5.60% 1.49% 0.00% NA
All Japonica  1512 100.00% 0.00% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 79.30% 14.30% 6.39% 0.00% NA
Indica II  465 95.90% 3.90% 0.22% 0.00% NA
Indica III  913 99.80% 0.20% 0.00% 0.00% NA
Indica Intermediate  786 93.50% 6.20% 0.25% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 96.70% 2.20% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0918877233 G -> A LOC_Os09g31390.1 5_prime_UTR_variant ; 170.0bp to feature; MODIFIER silent_mutation Average:74.111; most accessible tissue: Callus, score: 94.693 N N N N
vg0918877233 G -> A LOC_Os09g31390.2 5_prime_UTR_variant ; 170.0bp to feature; MODIFIER silent_mutation Average:74.111; most accessible tissue: Callus, score: 94.693 N N N N
vg0918877233 G -> A LOC_Os09g31390.3 upstream_gene_variant ; 2793.0bp to feature; MODIFIER silent_mutation Average:74.111; most accessible tissue: Callus, score: 94.693 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0918877233 4.35E-07 3.59E-11 mr1138 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918877233 NA 1.16E-08 mr1707 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918877233 NA 1.74E-11 mr1728 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918877233 NA 1.19E-07 mr1860 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918877233 1.14E-08 3.58E-11 mr1138_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918877233 4.35E-06 2.61E-10 mr1707_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918877233 3.13E-07 2.68E-13 mr1728_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918877233 NA 1.34E-08 mr1860_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251