\
| Variant ID: vg0918877233 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 18877233 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 340. )
CCGAAACATACACAGAGAAGGCAAGGTAGCAAGCTATATACGTATGCGTATGTGCCTCTATCTATCTATAGCCATAGCTGCAAGGTCCTAAATACTCTTT[G/A]
ACTCTATGAGGCTAGCAGCCAAGGCGCCACCTCTCTCTCTCTCACTCACTTTCTCTCTTCCTCTTCCACACCAGCAACTACCCCATGCATGACCTCTAGC
GCTAGAGGTCATGCATGGGGTAGTTGCTGGTGTGGAAGAGGAAGAGAGAAAGTGAGTGAGAGAGAGAGAGGTGGCGCCTTGGCTGCTAGCCTCATAGAGT[C/T]
AAAGAGTATTTAGGACCTTGCAGCTATGGCTATAGATAGATAGAGGCACATACGCATACGTATATAGCTTGCTACCTTGCCTTCTCTGTGTATGTTTCGG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 95.80% | 3.30% | 0.89% | 0.00% | NA |
| All Indica | 2759 | 92.90% | 5.60% | 1.49% | 0.00% | NA |
| All Japonica | 1512 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 79.30% | 14.30% | 6.39% | 0.00% | NA |
| Indica II | 465 | 95.90% | 3.90% | 0.22% | 0.00% | NA |
| Indica III | 913 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 93.50% | 6.20% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 96.70% | 2.20% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0918877233 | G -> A | LOC_Os09g31390.1 | 5_prime_UTR_variant ; 170.0bp to feature; MODIFIER | silent_mutation | Average:74.111; most accessible tissue: Callus, score: 94.693 | N | N | N | N |
| vg0918877233 | G -> A | LOC_Os09g31390.2 | 5_prime_UTR_variant ; 170.0bp to feature; MODIFIER | silent_mutation | Average:74.111; most accessible tissue: Callus, score: 94.693 | N | N | N | N |
| vg0918877233 | G -> A | LOC_Os09g31390.3 | upstream_gene_variant ; 2793.0bp to feature; MODIFIER | silent_mutation | Average:74.111; most accessible tissue: Callus, score: 94.693 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0918877233 | 4.35E-07 | 3.59E-11 | mr1138 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0918877233 | NA | 1.16E-08 | mr1707 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0918877233 | NA | 1.74E-11 | mr1728 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0918877233 | NA | 1.19E-07 | mr1860 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0918877233 | 1.14E-08 | 3.58E-11 | mr1138_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0918877233 | 4.35E-06 | 2.61E-10 | mr1707_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0918877233 | 3.13E-07 | 2.68E-13 | mr1728_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0918877233 | NA | 1.34E-08 | mr1860_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |