\
| Variant ID: vg0918876795 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 18876795 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, G: 0.00, others allele: 0.00, population size: 313. )
CAAGAAAAAAGAACCAAACCAAAACAAACCATGCATGATCATGACTAACAAATCAGAGATCAAAATCAAACTCCAAGACACGGCCCAAATCAAGAACAAG[A/G]
AAGAGACACACATATATATGCATCAAACAAATCAGAGAGAGAGAGAGAGAGGGAGAGAGATTCAGTAAACAAAGCCGTACATGAAGCTTGCGGCAGCGGC
GCCGCTGCCGCAAGCTTCATGTACGGCTTTGTTTACTGAATCTCTCTCCCTCTCTCTCTCTCTCTCTGATTTGTTTGATGCATATATATGTGTGTCTCTT[T/C]
CTTGTTCTTGATTTGGGCCGTGTCTTGGAGTTTGATTTTGATCTCTGATTTGTTAGTCATGATCATGCATGGTTTGTTTTGGTTTGGTTCTTTTTTCTTG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 92.30% | 7.60% | 0.06% | 0.00% | NA |
| All Indica | 2759 | 98.50% | 1.50% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 92.90% | 7.00% | 0.07% | 0.00% | NA |
| Aus | 269 | 49.40% | 50.20% | 0.37% | 0.00% | NA |
| Indica I | 595 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
| Indica III | 913 | 98.60% | 1.30% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 96.90% | 3.10% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 92.70% | 7.20% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 90.50% | 9.50% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 98.80% | 1.20% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 29.20% | 70.80% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 90.00% | 10.00% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0918876795 | A -> G | LOC_Os09g31390.3 | upstream_gene_variant ; 2355.0bp to feature; MODIFIER | silent_mutation | Average:40.434; most accessible tissue: Zhenshan97 young leaf, score: 70.625 | N | N | N | N |
| vg0918876795 | A -> G | LOC_Os09g31390.1 | intron_variant ; MODIFIER | silent_mutation | Average:40.434; most accessible tissue: Zhenshan97 young leaf, score: 70.625 | N | N | N | N |
| vg0918876795 | A -> G | LOC_Os09g31390.2 | intron_variant ; MODIFIER | silent_mutation | Average:40.434; most accessible tissue: Zhenshan97 young leaf, score: 70.625 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0918876795 | NA | 6.82E-06 | mr1230_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0918876795 | 9.48E-07 | 4.91E-08 | mr1252_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0918876795 | 6.39E-06 | 1.02E-06 | mr1263_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0918876795 | NA | 1.21E-06 | mr1405_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0918876795 | 2.52E-06 | NA | mr1567_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0918876795 | 2.82E-06 | NA | mr1591_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0918876795 | 2.46E-06 | NA | mr1594_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0918876795 | 5.95E-06 | NA | mr1596_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0918876795 | NA | 7.62E-07 | mr1597_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0918876795 | NA | 9.59E-06 | mr1661_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0918876795 | 6.96E-06 | 6.52E-08 | mr1729_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0918876795 | NA | 8.75E-06 | mr1736_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0918876795 | NA | 3.71E-06 | mr1740_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |