\
| Variant ID: vg0918827520 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 18827520 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TTAGTGTAACATTGTCACGCCCAGAAATTCCCGAATAGAATTCCAAGCAGAATGTGCATTAAAATCCCCGTCCAGGACCAGCCGGGGTACACAAACGACA[G/A]
TGTTGACATTCAGATCCACGTCTTACAAACATCATAAAAGATTACAAATGCAGCGGAAAAAGATAAAAGCGAGCTAAGCCTGAAGGCTTGACTCCTGCAG
CTGCAGGAGTCAAGCCTTCAGGCTTAGCTCGCTTTTATCTTTTTCCGCTGCATTTGTAATCTTTTATGATGTTTGTAAGACGTGGATCTGAATGTCAACA[C/T]
TGTCGTTTGTGTACCCCGGCTGGTCCTGGACGGGGATTTTAATGCACATTCTGCTTGGAATTCTATTCGGGAATTTCTGGGCGTGACAATGTTACACTAA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 28.00% | 0.40% | 5.44% | 66.19% | NA |
| All Indica | 2759 | 3.10% | 0.40% | 5.76% | 90.69% | NA |
| All Japonica | 1512 | 77.10% | 0.10% | 3.17% | 19.64% | NA |
| Aus | 269 | 3.70% | 1.50% | 10.78% | 84.01% | NA |
| Indica I | 595 | 3.00% | 0.00% | 0.67% | 96.30% | NA |
| Indica II | 465 | 3.90% | 0.40% | 2.37% | 93.33% | NA |
| Indica III | 913 | 1.30% | 0.80% | 10.62% | 87.29% | NA |
| Indica Intermediate | 786 | 4.80% | 0.40% | 5.98% | 88.80% | NA |
| Temperate Japonica | 767 | 70.90% | 0.00% | 2.74% | 26.34% | NA |
| Tropical Japonica | 504 | 88.50% | 0.20% | 1.39% | 9.92% | NA |
| Japonica Intermediate | 241 | 73.00% | 0.00% | 8.30% | 18.67% | NA |
| VI/Aromatic | 96 | 17.70% | 1.00% | 11.46% | 69.79% | NA |
| Intermediate | 90 | 48.90% | 0.00% | 11.11% | 40.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0918827520 | G -> DEL | N | N | silent_mutation | Average:35.085; most accessible tissue: Zhenshan97 panicle, score: 69.946 | N | N | N | N |
| vg0918827520 | G -> A | LOC_Os09g31310.1 | upstream_gene_variant ; 1258.0bp to feature; MODIFIER | silent_mutation | Average:35.085; most accessible tissue: Zhenshan97 panicle, score: 69.946 | N | N | N | N |
| vg0918827520 | G -> A | LOC_Os09g31310-LOC_Os09g31330 | intergenic_region ; MODIFIER | silent_mutation | Average:35.085; most accessible tissue: Zhenshan97 panicle, score: 69.946 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0918827520 | NA | 4.09E-16 | mr1164 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0918827520 | NA | 2.14E-11 | mr1172 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0918827520 | NA | 1.11E-60 | mr1246 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0918827520 | NA | 1.20E-07 | mr1249 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0918827520 | 2.84E-06 | 1.18E-06 | mr1322 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0918827520 | NA | 1.52E-12 | mr1326 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0918827520 | NA | 1.28E-23 | mr1571 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0918827520 | NA | 9.67E-19 | mr1598 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0918827520 | 8.95E-06 | 8.15E-06 | mr1712 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0918827520 | 5.75E-07 | NA | mr1719 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0918827520 | 5.03E-09 | 5.47E-09 | mr1719 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0918827520 | NA | 8.57E-13 | mr1514_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0918827520 | NA | 1.88E-33 | mr1598_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0918827520 | NA | 1.37E-07 | mr1676_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |