\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0918787679:

Variant ID: vg0918787679 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 18787679
Reference Allele: TAlternative Allele: A
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 122. )

Flanking Sequence (100 bp) in Reference Genome:


CACACCGCACAACAGCGCACACGAACTAGATTGGGGGATGATGATTCGGGCCGGGGAAGCGGAACGGCGGAGGTGGTGGGGGCAAAAAAAAATAATAATA[T/A]
ATCAGAATGCTCCTCACCTCACCTGCCTGTGCCTGTTGCAATTTCGCCGCTTCAGTTGCCGCGACGCGAGCCCGAGCGGTTGCCGACTCCAAATCCGAGC

Reverse complement sequence

GCTCGGATTTGGAGTCGGCAACCGCTCGGGCTCGCGTCGCGGCAACTGAAGCGGCGAAATTGCAACAGGCACAGGCAGGTGAGGTGAGGAGCATTCTGAT[A/T]
TATTATTATTTTTTTTTGCCCCCACCACCTCCGCCGTTCCGCTTCCCCGGCCCGAATCATCATCCCCCAATCTAGTTCGTGTGCGCTGTTGTGCGGTGTG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 59.10% 33.90% 4.87% 2.16% NA
All Indica  2759 84.60% 4.80% 7.00% 3.66% NA
All Japonica  1512 19.30% 80.70% 0.00% 0.00% NA
Aus  269 45.00% 44.20% 10.78% 0.00% NA
Indica I  595 88.10% 2.00% 9.08% 0.84% NA
Indica II  465 74.60% 5.40% 8.39% 11.61% NA
Indica III  913 90.60% 3.90% 4.82% 0.66% NA
Indica Intermediate  786 80.80% 7.50% 7.12% 4.58% NA
Temperate Japonica  767 4.40% 95.60% 0.00% 0.00% NA
Tropical Japonica  504 26.60% 73.40% 0.00% 0.00% NA
Japonica Intermediate  241 51.50% 48.50% 0.00% 0.00% NA
VI/Aromatic  96 17.70% 82.30% 0.00% 0.00% NA
Intermediate  90 33.30% 56.70% 8.89% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0918787679 T -> DEL N N silent_mutation Average:80.494; most accessible tissue: Callus, score: 92.635 N N N N
vg0918787679 T -> A LOC_Os09g31250.1 upstream_gene_variant ; 4190.0bp to feature; MODIFIER silent_mutation Average:80.494; most accessible tissue: Callus, score: 92.635 N N N N
vg0918787679 T -> A LOC_Os09g31240.1 downstream_gene_variant ; 1907.0bp to feature; MODIFIER silent_mutation Average:80.494; most accessible tissue: Callus, score: 92.635 N N N N
vg0918787679 T -> A LOC_Os09g31230.1 intron_variant ; MODIFIER silent_mutation Average:80.494; most accessible tissue: Callus, score: 92.635 N N N N
vg0918787679 T -> A LOC_Os09g31230.2 intron_variant ; MODIFIER silent_mutation Average:80.494; most accessible tissue: Callus, score: 92.635 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0918787679 T A -0.07 -0.01 0.0 0.0 -0.01 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0918787679 NA 1.57E-06 mr1114 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918787679 NA 1.47E-07 mr1117 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918787679 NA 3.85E-07 mr1118 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918787679 NA 5.54E-07 mr1119 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918787679 NA 4.55E-07 mr1240 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918787679 NA 2.58E-08 mr1496 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918787679 NA 2.70E-06 mr1518 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918787679 NA 8.19E-07 mr1676 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918787679 NA 4.58E-09 mr1961 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918787679 2.71E-06 2.71E-06 mr1041_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918787679 NA 7.04E-06 mr1113_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918787679 NA 6.40E-07 mr1117_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918787679 NA 1.76E-06 mr1119_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918787679 NA 5.68E-07 mr1240_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918787679 9.51E-06 9.51E-06 mr1294_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918787679 NA 1.31E-06 mr1417_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918787679 NA 2.59E-06 mr1488_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918787679 NA 4.12E-06 mr1492_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918787679 2.50E-06 2.50E-06 mr1494_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918787679 NA 5.62E-08 mr1496_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918787679 4.57E-06 4.57E-06 mr1497_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918787679 NA 4.14E-06 mr1519_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918787679 NA 8.02E-07 mr1556_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918787679 9.44E-07 9.43E-07 mr1604_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918787679 NA 4.80E-06 mr1646_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918787679 NA 5.56E-08 mr1676_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918787679 NA 7.73E-07 mr1764_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918787679 NA 6.77E-07 mr1779_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918787679 NA 2.72E-06 mr1813_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918787679 2.40E-06 2.40E-06 mr1814_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918787679 5.61E-06 5.61E-06 mr1823_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918787679 7.43E-07 7.43E-07 mr1824_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918787679 NA 5.66E-06 mr1840_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918787679 4.61E-06 4.61E-06 mr1840_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918787679 NA 2.84E-07 mr1894_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251