\
| Variant ID: vg0918671171 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 18671171 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.99, others allele: 0.00, population size: 345. )
GTCATACTCCTGTACTTTGTATTGGAAATTTGAAATCGTCATTGGTTGCCTCCGTGTGCGCTTGTCACGGATTTGGAAATTTGGATAGAGTCGCATCAGT[C/T]
TGAACACCAATTCAGTTCAGTGGTTTGCCTTTGAATTGTGTTTATTCTAGTGATTACTGTGTTCTGCATCGGTTGCAATACACGCTGTACAGTTTTTTTC
GAAAAAAACTGTACAGCGTGTATTGCAACCGATGCAGAACACAGTAATCACTAGAATAAACACAATTCAAAGGCAAACCACTGAACTGAATTGGTGTTCA[G/A]
ACTGATGCGACTCTATCCAAATTTCCAAATCCGTGACAAGCGCACACGGAGGCAACCAATGACGATTTCAAATTTCCAATACAAAGTACAGGAGTATGAC
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 70.00% | 30.00% | 0.02% | 0.00% | NA |
| All Indica | 2759 | 98.30% | 1.70% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 13.60% | 86.40% | 0.00% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.00% | 0.37% | 0.00% | NA |
| Indica I | 595 | 98.20% | 1.80% | 0.00% | 0.00% | NA |
| Indica II | 465 | 96.30% | 3.70% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 97.80% | 2.20% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 10.70% | 89.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 21.00% | 79.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 7.50% | 92.50% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 78.10% | 21.90% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 50.00% | 50.00% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0918671171 | C -> T | LOC_Os09g31031.3 | splice_region_variant ; LOW | silent_mutation | Average:63.666; most accessible tissue: Zhenshan97 panicle, score: 81.752 | N | N | N | N |
| vg0918671171 | C -> T | LOC_Os09g31031.3 | 3_prime_UTR_variant ; 171.0bp to feature; MODIFIER | silent_mutation | Average:63.666; most accessible tissue: Zhenshan97 panicle, score: 81.752 | N | N | N | N |
| vg0918671171 | C -> T | LOC_Os09g31040.1 | upstream_gene_variant ; 966.0bp to feature; MODIFIER | silent_mutation | Average:63.666; most accessible tissue: Zhenshan97 panicle, score: 81.752 | N | N | N | N |
| vg0918671171 | C -> T | LOC_Os09g31060.1 | upstream_gene_variant ; 4008.0bp to feature; MODIFIER | silent_mutation | Average:63.666; most accessible tissue: Zhenshan97 panicle, score: 81.752 | N | N | N | N |
| vg0918671171 | C -> T | LOC_Os09g31025.1 | downstream_gene_variant ; 2919.0bp to feature; MODIFIER | silent_mutation | Average:63.666; most accessible tissue: Zhenshan97 panicle, score: 81.752 | N | N | N | N |
| vg0918671171 | C -> T | LOC_Os09g31050.1 | downstream_gene_variant ; 2159.0bp to feature; MODIFIER | silent_mutation | Average:63.666; most accessible tissue: Zhenshan97 panicle, score: 81.752 | N | N | N | N |
| vg0918671171 | C -> T | LOC_Os09g31031.1 | intron_variant ; MODIFIER | silent_mutation | Average:63.666; most accessible tissue: Zhenshan97 panicle, score: 81.752 | N | N | N | N |
| vg0918671171 | C -> T | LOC_Os09g31031.2 | intron_variant ; MODIFIER | silent_mutation | Average:63.666; most accessible tissue: Zhenshan97 panicle, score: 81.752 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0918671171 | NA | 2.21E-10 | Grain_weight | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0918671171 | 2.00E-06 | NA | mr1125 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0918671171 | NA | 5.49E-15 | mr1276 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0918671171 | NA | 7.88E-06 | mr1532 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0918671171 | NA | 1.78E-07 | mr1690 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0918671171 | NA | 3.33E-22 | mr1010_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0918671171 | NA | 2.74E-24 | mr1588_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |