\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0918671171:

Variant ID: vg0918671171 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 18671171
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.99, others allele: 0.00, population size: 345. )

Flanking Sequence (100 bp) in Reference Genome:


GTCATACTCCTGTACTTTGTATTGGAAATTTGAAATCGTCATTGGTTGCCTCCGTGTGCGCTTGTCACGGATTTGGAAATTTGGATAGAGTCGCATCAGT[C/T]
TGAACACCAATTCAGTTCAGTGGTTTGCCTTTGAATTGTGTTTATTCTAGTGATTACTGTGTTCTGCATCGGTTGCAATACACGCTGTACAGTTTTTTTC

Reverse complement sequence

GAAAAAAACTGTACAGCGTGTATTGCAACCGATGCAGAACACAGTAATCACTAGAATAAACACAATTCAAAGGCAAACCACTGAACTGAATTGGTGTTCA[G/A]
ACTGATGCGACTCTATCCAAATTTCCAAATCCGTGACAAGCGCACACGGAGGCAACCAATGACGATTTCAAATTTCCAATACAAAGTACAGGAGTATGAC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 70.00% 30.00% 0.02% 0.00% NA
All Indica  2759 98.30% 1.70% 0.00% 0.00% NA
All Japonica  1512 13.60% 86.40% 0.00% 0.00% NA
Aus  269 99.60% 0.00% 0.37% 0.00% NA
Indica I  595 98.20% 1.80% 0.00% 0.00% NA
Indica II  465 96.30% 3.70% 0.00% 0.00% NA
Indica III  913 99.80% 0.20% 0.00% 0.00% NA
Indica Intermediate  786 97.80% 2.20% 0.00% 0.00% NA
Temperate Japonica  767 10.70% 89.30% 0.00% 0.00% NA
Tropical Japonica  504 21.00% 79.00% 0.00% 0.00% NA
Japonica Intermediate  241 7.50% 92.50% 0.00% 0.00% NA
VI/Aromatic  96 78.10% 21.90% 0.00% 0.00% NA
Intermediate  90 50.00% 50.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0918671171 C -> T LOC_Os09g31031.3 splice_region_variant ; LOW silent_mutation Average:63.666; most accessible tissue: Zhenshan97 panicle, score: 81.752 N N N N
vg0918671171 C -> T LOC_Os09g31031.3 3_prime_UTR_variant ; 171.0bp to feature; MODIFIER silent_mutation Average:63.666; most accessible tissue: Zhenshan97 panicle, score: 81.752 N N N N
vg0918671171 C -> T LOC_Os09g31040.1 upstream_gene_variant ; 966.0bp to feature; MODIFIER silent_mutation Average:63.666; most accessible tissue: Zhenshan97 panicle, score: 81.752 N N N N
vg0918671171 C -> T LOC_Os09g31060.1 upstream_gene_variant ; 4008.0bp to feature; MODIFIER silent_mutation Average:63.666; most accessible tissue: Zhenshan97 panicle, score: 81.752 N N N N
vg0918671171 C -> T LOC_Os09g31025.1 downstream_gene_variant ; 2919.0bp to feature; MODIFIER silent_mutation Average:63.666; most accessible tissue: Zhenshan97 panicle, score: 81.752 N N N N
vg0918671171 C -> T LOC_Os09g31050.1 downstream_gene_variant ; 2159.0bp to feature; MODIFIER silent_mutation Average:63.666; most accessible tissue: Zhenshan97 panicle, score: 81.752 N N N N
vg0918671171 C -> T LOC_Os09g31031.1 intron_variant ; MODIFIER silent_mutation Average:63.666; most accessible tissue: Zhenshan97 panicle, score: 81.752 N N N N
vg0918671171 C -> T LOC_Os09g31031.2 intron_variant ; MODIFIER silent_mutation Average:63.666; most accessible tissue: Zhenshan97 panicle, score: 81.752 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0918671171 NA 2.21E-10 Grain_weight All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0918671171 2.00E-06 NA mr1125 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918671171 NA 5.49E-15 mr1276 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918671171 NA 7.88E-06 mr1532 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918671171 NA 1.78E-07 mr1690 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918671171 NA 3.33E-22 mr1010_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918671171 NA 2.74E-24 mr1588_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251