| Variant ID: vg0918661273 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 18661273 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 254. )
ATTCAAAGGATTAGAGTTTTCCAAATCGTATAAAATTCCTATAGAATAGATCATTACATGTAGATTTTGGAGGAAACTTAGCAAAATGTTAAACCTCTTG[G/A]
AAAAATTCCTTTGAATCTATCTCTCTCATCCGATTTCTGTGTTTTTCATACGGTCCAATCAAACAACTATTACCGTGTTTGGAATCCTCCGTTTTACACT
AGTGTAAAACGGAGGATTCCAAACACGGTAATAGTTGTTTGATTGGACCGTATGAAAAACACAGAAATCGGATGAGAGAGATAGATTCAAAGGAATTTTT[C/T]
CAAGAGGTTTAACATTTTGCTAAGTTTCCTCCAAAATCTACATGTAATGATCTATTCTATAGGAATTTTATACGATTTGGAAAACTCTAATCCTTTGAAT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 96.40% | 3.10% | 0.42% | 0.00% | NA |
| All Indica | 2759 | 99.90% | 0.10% | 0.07% | 0.00% | NA |
| All Japonica | 1512 | 89.50% | 9.40% | 1.12% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.80% | 0.00% | 0.22% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.60% | 0.30% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 99.70% | 0.00% | 0.26% | 0.00% | NA |
| Tropical Japonica | 504 | 70.00% | 27.40% | 2.58% | 0.00% | NA |
| Japonica Intermediate | 241 | 97.50% | 1.70% | 0.83% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 94.40% | 4.40% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0918661273 | G -> A | LOC_Os09g30980.1 | upstream_gene_variant ; 2096.0bp to feature; MODIFIER | silent_mutation | Average:37.054; most accessible tissue: Callus, score: 57.625 | N | N | N | N |
| vg0918661273 | G -> A | LOC_Os09g30990.1 | upstream_gene_variant ; 492.0bp to feature; MODIFIER | silent_mutation | Average:37.054; most accessible tissue: Callus, score: 57.625 | N | N | N | N |
| vg0918661273 | G -> A | LOC_Os09g31000.1 | upstream_gene_variant ; 1609.0bp to feature; MODIFIER | silent_mutation | Average:37.054; most accessible tissue: Callus, score: 57.625 | N | N | N | N |
| vg0918661273 | G -> A | LOC_Os09g31019.1 | upstream_gene_variant ; 2831.0bp to feature; MODIFIER | silent_mutation | Average:37.054; most accessible tissue: Callus, score: 57.625 | N | N | N | N |
| vg0918661273 | G -> A | LOC_Os09g30990-LOC_Os09g31000 | intergenic_region ; MODIFIER | silent_mutation | Average:37.054; most accessible tissue: Callus, score: 57.625 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0918661273 | NA | 3.50E-07 | mr1125 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0918661273 | NA | 5.98E-07 | mr1136 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0918661273 | NA | 7.00E-08 | mr1188 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0918661273 | NA | 8.14E-08 | mr1448 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0918661273 | NA | 6.80E-07 | mr1047_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0918661273 | 3.34E-06 | 4.84E-10 | mr1125_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0918661273 | 3.35E-08 | 6.59E-12 | mr1188_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |