Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0918661273:

Variant ID: vg0918661273 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 18661273
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 254. )

Flanking Sequence (100 bp) in Reference Genome:

ATTCAAAGGATTAGAGTTTTCCAAATCGTATAAAATTCCTATAGAATAGATCATTACATGTAGATTTTGGAGGAAACTTAGCAAAATGTTAAACCTCTTG[G/A]
AAAAATTCCTTTGAATCTATCTCTCTCATCCGATTTCTGTGTTTTTCATACGGTCCAATCAAACAACTATTACCGTGTTTGGAATCCTCCGTTTTACACT

Reverse complement sequence

AGTGTAAAACGGAGGATTCCAAACACGGTAATAGTTGTTTGATTGGACCGTATGAAAAACACAGAAATCGGATGAGAGAGATAGATTCAAAGGAATTTTT[C/T]
CAAGAGGTTTAACATTTTGCTAAGTTTCCTCCAAAATCTACATGTAATGATCTATTCTATAGGAATTTTATACGATTTGGAAAACTCTAATCCTTTGAAT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	96.40%	3.10%	0.42%	0.00%	NA
All Indica	2759	99.90%	0.10%	0.07%	0.00%	NA
All Japonica	1512	89.50%	9.40%	1.12%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	99.80%	0.00%	0.22%	0.00%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	99.60%	0.30%	0.13%	0.00%	NA
Temperate Japonica	767	99.70%	0.00%	0.26%	0.00%	NA
Tropical Japonica	504	70.00%	27.40%	2.58%	0.00%	NA
Japonica Intermediate	241	97.50%	1.70%	0.83%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	94.40%	4.40%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0918661273	G -> A	LOC_Os09g30980.1	upstream_gene_variant ; 2096.0bp to feature; MODIFIER	silent_mutation	Average:37.054; most accessible tissue: Callus, score: 57.625	N	N	N	N
vg0918661273	G -> A	LOC_Os09g30990.1	upstream_gene_variant ; 492.0bp to feature; MODIFIER	silent_mutation	Average:37.054; most accessible tissue: Callus, score: 57.625	N	N	N	N
vg0918661273	G -> A	LOC_Os09g31000.1	upstream_gene_variant ; 1609.0bp to feature; MODIFIER	silent_mutation	Average:37.054; most accessible tissue: Callus, score: 57.625	N	N	N	N
vg0918661273	G -> A	LOC_Os09g31019.1	upstream_gene_variant ; 2831.0bp to feature; MODIFIER	silent_mutation	Average:37.054; most accessible tissue: Callus, score: 57.625	N	N	N	N
vg0918661273	G -> A	LOC_Os09g30990-LOC_Os09g31000	intergenic_region ; MODIFIER	silent_mutation	Average:37.054; most accessible tissue: Callus, score: 57.625	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0918661273	NA	3.50E-07	mr1125	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918661273	NA	5.98E-07	mr1136	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918661273	NA	7.00E-08	mr1188	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918661273	NA	8.14E-08	mr1448	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918661273	NA	6.80E-07	mr1047_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918661273	3.34E-06	4.84E-10	mr1125_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918661273	3.35E-08	6.59E-12	mr1188_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251