\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0918646540:

Variant ID: vg0918646540 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 18646540
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.01, others allele: 0.00, population size: 107. )

Flanking Sequence (100 bp) in Reference Genome:


ATTAATCTCGTATTGGGTTCTTATATGGATTCTTCTTTCAATATTGCTTATTTTTAATTCTGAATTTCAGCTAATTTTAAATTGTATTCCTTCATGAACT[C/T]
TTCTTTTATTTTCTTTTGCTAATTTCGGAATTATTTATTTTTATTTCGAATTTTAATTAATCTCGTATTGGGTTATTATATGGACTCTTCTTTTATTATT

Reverse complement sequence

AATAATAAAAGAAGAGTCCATATAATAACCCAATACGAGATTAATTAAAATTCGAAATAAAAATAAATAATTCCGAAATTAGCAAAAGAAAATAAAAGAA[G/A]
AGTTCATGAAGGAATACAATTTAAAATTAGCTGAAATTCAGAATTAAAAATAAGCAATATTGAAAGAAGAATCCATATAAGAACCCAATACGAGATTAAT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 52.10% 43.90% 2.69% 1.29% NA
All Indica  2759 86.90% 7.00% 3.95% 2.14% NA
All Japonica  1512 0.20% 98.70% 1.12% 0.00% NA
Aus  269 15.60% 84.40% 0.00% 0.00% NA
Indica I  595 90.80% 6.20% 2.69% 0.34% NA
Indica II  465 82.40% 4.90% 5.81% 6.88% NA
Indica III  913 93.60% 3.10% 2.08% 1.20% NA
Indica Intermediate  786 78.90% 13.40% 5.98% 1.78% NA
Temperate Japonica  767 0.10% 99.10% 0.78% 0.00% NA
Tropical Japonica  504 0.20% 99.00% 0.79% 0.00% NA
Japonica Intermediate  241 0.40% 96.70% 2.90% 0.00% NA
VI/Aromatic  96 1.00% 99.00% 0.00% 0.00% NA
Intermediate  90 20.00% 76.70% 1.11% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0918646540 C -> DEL N N silent_mutation Average:13.358; most accessible tissue: Minghui63 panicle, score: 20.733 N N N N
vg0918646540 C -> T LOC_Os09g30510.1 upstream_gene_variant ; 2542.0bp to feature; MODIFIER silent_mutation Average:13.358; most accessible tissue: Minghui63 panicle, score: 20.733 N N N N
vg0918646540 C -> T LOC_Os09g30506.1 downstream_gene_variant ; 4231.0bp to feature; MODIFIER silent_mutation Average:13.358; most accessible tissue: Minghui63 panicle, score: 20.733 N N N N
vg0918646540 C -> T LOC_Os09g30510-LOC_Os09g30970 intergenic_region ; MODIFIER silent_mutation Average:13.358; most accessible tissue: Minghui63 panicle, score: 20.733 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0918646540 NA 2.50E-16 mr1199 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918646540 NA 4.39E-33 mr1224 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918646540 NA 2.19E-30 mr1225 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918646540 NA 3.13E-14 mr1233 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918646540 NA 3.51E-64 mr1246 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918646540 NA 5.98E-06 mr1246 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918646540 NA 2.46E-09 mr1299 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918646540 NA 1.30E-08 mr1342 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918646540 NA 4.32E-10 mr1379 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918646540 NA 8.30E-35 mr1404 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918646540 4.11E-09 NA mr1557 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918646540 NA 4.97E-10 mr1559 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918646540 6.56E-07 2.32E-22 mr1598 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918646540 NA 4.20E-25 mr1233_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918646540 NA 1.36E-06 mr1559_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918646540 5.49E-07 2.64E-37 mr1598_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918646540 NA 5.90E-09 mr1751_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918646540 NA 1.01E-22 mr1949_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251