Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0918591039:

Variant ID: vg0918591039 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 18591039
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 78. )

Flanking Sequence (100 bp) in Reference Genome:

GCCATTTGTTAATCTCTGTTCATGTTCTACTTCATCTATTCAAACGATTATTTTCGCGAGTGTGAGGACTGAACTTTCCCTAACCAGCAATCTTCACTCG[C/T]
GATCAAGCTAAGCTGGGCGCCGTAGCCAGCCGGCAGGGCCAAAGCCAGCTGCTACGGAAGAGCTAGCATAGGGGGCCCCAGGCGTCGACGGTACCCAGAG

Reverse complement sequence

CTCTGGGTACCGTCGACGCCTGGGGCCCCCTATGCTAGCTCTTCCGTAGCAGCTGGCTTTGGCCCTGCCGGCTGGCTACGGCGCCCAGCTTAGCTTGATC[G/A]
CGAGTGAAGATTGCTGGTTAGGGAAAGTTCAGTCCTCACACTCGCGAAAATAATCGTTTGAATAGATGAAGTAGAACATGAACAGAGATTAACAAATGGC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	45.80%	5.20%	32.27%	16.67%	NA
All Indica	2759	8.00%	8.80%	54.69%	28.45%	NA
All Japonica	1512	99.90%	0.10%	0.07%	0.00%	NA
Aus	269	99.60%	0.00%	0.37%	0.00%	NA
Indica I	595	6.90%	4.50%	41.51%	47.06%	NA
Indica II	465	5.80%	4.90%	69.03%	20.22%	NA
Indica III	913	4.10%	12.70%	62.43%	20.81%	NA
Indica Intermediate	786	14.80%	9.90%	47.20%	28.12%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	99.60%	0.20%	0.20%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	99.00%	0.00%	1.04%	0.00%	NA
Intermediate	90	80.00%	2.20%	14.44%	3.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0918591039	C -> DEL	N	N	silent_mutation	Average:48.161; most accessible tissue: Minghui63 flag leaf, score: 58.568	N	N	N	N
vg0918591039	C -> T	LOC_Os09g30478-LOC_Os09g30486	intergenic_region ; MODIFIER	silent_mutation	Average:48.161; most accessible tissue: Minghui63 flag leaf, score: 58.568	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0918591039	NA	5.30E-09	mr1047	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918591039	NA	4.98E-10	mr1151	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918591039	4.40E-07	NA	mr1557	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918591039	NA	1.39E-07	mr1559	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918591039	4.92E-06	7.85E-22	mr1598	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918591039	NA	9.15E-13	mr1189_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918591039	NA	4.24E-06	mr1246_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918591039	NA	5.29E-26	mr1323_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918591039	NA	3.53E-06	mr1346_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918591039	NA	2.04E-07	mr1527_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918591039	1.97E-08	NA	mr1557_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918591039	1.75E-07	NA	mr1557_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918591039	2.78E-11	2.13E-42	mr1598_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918591039	1.67E-09	3.60E-09	mr1598_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918591039	NA	1.38E-09	mr1649_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918591039	NA	5.52E-11	mr1734_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918591039	NA	1.11E-16	mr1744_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918591039	NA	4.65E-10	mr1782_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251