\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0918591039:

Variant ID: vg0918591039 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 18591039
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 78. )

Flanking Sequence (100 bp) in Reference Genome:


GCCATTTGTTAATCTCTGTTCATGTTCTACTTCATCTATTCAAACGATTATTTTCGCGAGTGTGAGGACTGAACTTTCCCTAACCAGCAATCTTCACTCG[C/T]
GATCAAGCTAAGCTGGGCGCCGTAGCCAGCCGGCAGGGCCAAAGCCAGCTGCTACGGAAGAGCTAGCATAGGGGGCCCCAGGCGTCGACGGTACCCAGAG

Reverse complement sequence

CTCTGGGTACCGTCGACGCCTGGGGCCCCCTATGCTAGCTCTTCCGTAGCAGCTGGCTTTGGCCCTGCCGGCTGGCTACGGCGCCCAGCTTAGCTTGATC[G/A]
CGAGTGAAGATTGCTGGTTAGGGAAAGTTCAGTCCTCACACTCGCGAAAATAATCGTTTGAATAGATGAAGTAGAACATGAACAGAGATTAACAAATGGC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 45.80% 5.20% 32.27% 16.67% NA
All Indica  2759 8.00% 8.80% 54.69% 28.45% NA
All Japonica  1512 99.90% 0.10% 0.07% 0.00% NA
Aus  269 99.60% 0.00% 0.37% 0.00% NA
Indica I  595 6.90% 4.50% 41.51% 47.06% NA
Indica II  465 5.80% 4.90% 69.03% 20.22% NA
Indica III  913 4.10% 12.70% 62.43% 20.81% NA
Indica Intermediate  786 14.80% 9.90% 47.20% 28.12% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 99.60% 0.20% 0.20% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 0.00% 1.04% 0.00% NA
Intermediate  90 80.00% 2.20% 14.44% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0918591039 C -> DEL N N silent_mutation Average:48.161; most accessible tissue: Minghui63 flag leaf, score: 58.568 N N N N
vg0918591039 C -> T LOC_Os09g30478-LOC_Os09g30486 intergenic_region ; MODIFIER silent_mutation Average:48.161; most accessible tissue: Minghui63 flag leaf, score: 58.568 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0918591039 NA 5.30E-09 mr1047 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918591039 NA 4.98E-10 mr1151 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918591039 4.40E-07 NA mr1557 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918591039 NA 1.39E-07 mr1559 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918591039 4.92E-06 7.85E-22 mr1598 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918591039 NA 9.15E-13 mr1189_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918591039 NA 4.24E-06 mr1246_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918591039 NA 5.29E-26 mr1323_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918591039 NA 3.53E-06 mr1346_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918591039 NA 2.04E-07 mr1527_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918591039 1.97E-08 NA mr1557_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918591039 1.75E-07 NA mr1557_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918591039 2.78E-11 2.13E-42 mr1598_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918591039 1.67E-09 3.60E-09 mr1598_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918591039 NA 1.38E-09 mr1649_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918591039 NA 5.52E-11 mr1734_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918591039 NA 1.11E-16 mr1744_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918591039 NA 4.65E-10 mr1782_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251