\
| Variant ID: vg0918591036 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 18591036 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.65, T: 0.35, others allele: 0.00, population size: 82. )
CCTGCCATTTGTTAATCTCTGTTCATGTTCTACTTCATCTATTCAAACGATTATTTTCGCGAGTGTGAGGACTGAACTTTCCCTAACCAGCAATCTTCAC[T/C]
CGCGATCAAGCTAAGCTGGGCGCCGTAGCCAGCCGGCAGGGCCAAAGCCAGCTGCTACGGAAGAGCTAGCATAGGGGGCCCCAGGCGTCGACGGTACCCA
TGGGTACCGTCGACGCCTGGGGCCCCCTATGCTAGCTCTTCCGTAGCAGCTGGCTTTGGCCCTGCCGGCTGGCTACGGCGCCCAGCTTAGCTTGATCGCG[A/G]
GTGAAGATTGCTGGTTAGGGAAAGTTCAGTCCTCACACTCGCGAAAATAATCGTTTGAATAGATGAAGTAGAACATGAACAGAGATTAACAAATGGCAGG
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 45.80% | 4.00% | 35.80% | 14.43% | NA |
| All Indica | 2759 | 9.20% | 6.80% | 59.33% | 24.65% | NA |
| All Japonica | 1512 | 99.90% | 0.00% | 0.07% | 0.00% | NA |
| Aus | 269 | 85.10% | 0.00% | 14.87% | 0.00% | NA |
| Indica I | 595 | 7.10% | 4.00% | 49.92% | 38.99% | NA |
| Indica II | 465 | 7.10% | 3.20% | 65.81% | 23.87% | NA |
| Indica III | 913 | 4.50% | 12.00% | 66.48% | 16.98% | NA |
| Indica Intermediate | 786 | 17.70% | 4.80% | 54.33% | 23.16% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.80% | 0.00% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 0.00% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 81.10% | 2.20% | 14.44% | 2.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0918591036 | T -> DEL | N | N | silent_mutation | Average:47.978; most accessible tissue: Minghui63 flag leaf, score: 57.881 | N | N | N | N |
| vg0918591036 | T -> C | LOC_Os09g30478-LOC_Os09g30486 | intergenic_region ; MODIFIER | silent_mutation | Average:47.978; most accessible tissue: Minghui63 flag leaf, score: 57.881 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0918591036 | NA | 5.42E-30 | mr1208 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0918591036 | NA | 9.48E-13 | mr1233 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0918591036 | NA | 1.26E-09 | mr1342 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0918591036 | 4.88E-08 | NA | mr1557 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0918591036 | NA | 1.64E-08 | mr1559 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0918591036 | 3.71E-06 | 4.05E-22 | mr1598 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0918591036 | NA | 2.02E-38 | mr1208_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0918591036 | NA | 1.06E-24 | mr1233_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0918591036 | NA | 2.84E-06 | mr1346_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0918591036 | 2.25E-08 | NA | mr1557_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0918591036 | 4.77E-06 | NA | mr1557_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0918591036 | NA | 1.35E-06 | mr1559_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0918591036 | 1.20E-11 | 1.38E-43 | mr1598_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0918591036 | 9.63E-09 | 2.31E-09 | mr1598_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0918591036 | NA | 1.36E-24 | mr1949_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0918591036 | NA | 9.60E-09 | mr1949_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |