\
| Variant ID: vg0918584653 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 18584653 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
ATTTAAGAATTTGCATGCTTCATTTGGAAGGAAATTAGGTTTTCTTTAGGGTTCCTTTGGAGCGTATGAATTCAAAAATACAGAAACAGGAAAAATGTAG[G/A]
AAGACGTGGCATACTAGCTAGTTGATCCATAGGAGTTTTAGAATGCAGAAATTGTGTGTAACTTGTTGTTGGATGCTCCATAGAAAAAGTATAGGATTTT
AAAATCCTATACTTTTTCTATGGAGCATCCAACAACAAGTTACACACAATTTCTGCATTCTAAAACTCCTATGGATCAACTAGCTAGTATGCCACGTCTT[C/T]
CTACATTTTTCCTGTTTCTGTATTTTTGAATTCATACGCTCCAAAGGAACCCTAAAGAAAACCTAATTTCCTTCCAAATGAAGCATGCAAATTCTTAAAT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 94.00% | 3.50% | 2.54% | 0.00% | NA |
| All Indica | 2759 | 89.90% | 5.90% | 4.28% | 0.00% | NA |
| All Japonica | 1512 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 72.40% | 15.30% | 12.27% | 0.00% | NA |
| Indica II | 465 | 94.60% | 3.00% | 2.37% | 0.00% | NA |
| Indica III | 913 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 88.90% | 6.70% | 4.33% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 95.60% | 2.20% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0918584653 | G -> A | LOC_Os09g30478.1 | downstream_gene_variant ; 3373.0bp to feature; MODIFIER | silent_mutation | Average:33.969; most accessible tissue: Callus, score: 54.962 | N | N | N | N |
| vg0918584653 | G -> A | LOC_Os09g30478-LOC_Os09g30486 | intergenic_region ; MODIFIER | silent_mutation | Average:33.969; most accessible tissue: Callus, score: 54.962 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0918584653 | 2.44E-06 | NA | mr1138 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0918584653 | NA | 1.86E-10 | mr1138 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0918584653 | NA | 1.61E-11 | mr1707 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0918584653 | NA | 1.40E-07 | mr1707 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0918584653 | 2.87E-06 | 3.27E-18 | mr1728 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0918584653 | NA | 2.63E-12 | mr1728 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0918584653 | NA | 5.94E-13 | mr1860 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0918584653 | NA | 3.12E-09 | mr1860 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0918584653 | 1.96E-08 | NA | mr1138_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0918584653 | 1.11E-07 | 2.70E-10 | mr1138_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0918584653 | 6.03E-07 | 7.48E-14 | mr1707_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0918584653 | NA | 7.18E-09 | mr1707_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0918584653 | 3.39E-10 | 3.85E-23 | mr1728_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0918584653 | 1.36E-08 | 2.73E-14 | mr1728_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0918584653 | NA | 1.57E-12 | mr1860_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0918584653 | NA | 1.76E-08 | mr1860_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |