\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0918542688:

Variant ID: vg0918542688 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 18542688
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.95, T: 0.05, others allele: 0.00, population size: 115. )

Flanking Sequence (100 bp) in Reference Genome:


AAGATGAGGAACAACAAACGAACTTATTCCAATCCGCTATGGAAGCTGATGGAAATTGGAAATTTGGGAATATTCGGTGCTAGGCCATATAAAAGAAACA[T/C]
TTGTACTTCTTATAGATTTCTTAATATTAAAAACAATCAAATCAAATATGAAAACATATAAAATCATCAAATTAAGGCAAAAAGAAAAAAGGATGTGTAA

Reverse complement sequence

TTACACATCCTTTTTTCTTTTTGCCTTAATTTGATGATTTTATATGTTTTCATATTTGATTTGATTGTTTTTAATATTAAGAAATCTATAAGAAGTACAA[A/G]
TGTTTCTTTTATATGGCCTAGCACCGAATATTCCCAAATTTCCAATTTCCATCAGCTTCCATAGCGGATTGGAATAAGTTCGTTTGTTGTTCCTCATCTT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 55.60% 43.80% 0.47% 0.06% NA
All Indica  2759 90.90% 8.40% 0.65% 0.07% NA
All Japonica  1512 2.80% 97.20% 0.00% 0.07% NA
Aus  269 14.90% 85.10% 0.00% 0.00% NA
Indica I  595 93.60% 5.70% 0.50% 0.17% NA
Indica II  465 94.60% 4.50% 0.65% 0.22% NA
Indica III  913 92.20% 7.30% 0.44% 0.00% NA
Indica Intermediate  786 85.10% 13.90% 1.02% 0.00% NA
Temperate Japonica  767 2.10% 97.90% 0.00% 0.00% NA
Tropical Japonica  504 3.80% 96.20% 0.00% 0.00% NA
Japonica Intermediate  241 2.90% 96.70% 0.00% 0.41% NA
VI/Aromatic  96 16.70% 82.30% 1.04% 0.00% NA
Intermediate  90 25.60% 71.10% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0918542688 T -> DEL N N silent_mutation Average:40.011; most accessible tissue: Callus, score: 86.127 N N N N
vg0918542688 T -> C LOC_Os09g30418.1 upstream_gene_variant ; 1579.0bp to feature; MODIFIER silent_mutation Average:40.011; most accessible tissue: Callus, score: 86.127 N N N N
vg0918542688 T -> C LOC_Os09g30442.1 downstream_gene_variant ; 146.0bp to feature; MODIFIER silent_mutation Average:40.011; most accessible tissue: Callus, score: 86.127 N N N N
vg0918542688 T -> C LOC_Os09g30446.1 downstream_gene_variant ; 1138.0bp to feature; MODIFIER silent_mutation Average:40.011; most accessible tissue: Callus, score: 86.127 N N N N
vg0918542688 T -> C LOC_Os09g30442-LOC_Os09g30446 intergenic_region ; MODIFIER silent_mutation Average:40.011; most accessible tissue: Callus, score: 86.127 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0918542688 NA 4.26E-09 mr1047 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918542688 NA 6.29E-10 mr1151 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918542688 8.32E-07 8.32E-07 mr1172 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918542688 NA 1.57E-07 mr1216 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918542688 NA 5.23E-06 mr1336 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918542688 7.54E-06 NA mr1557 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918542688 NA 1.83E-08 mr1559 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918542688 1.73E-06 1.85E-21 mr1598 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918542688 NA 2.45E-08 mr1707 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918542688 NA 9.55E-07 mr1707 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918542688 NA 2.32E-10 mr1047_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918542688 NA 2.66E-06 mr1047_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918542688 NA 2.81E-13 mr1189_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918542688 NA 9.75E-06 mr1189_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918542688 NA 2.55E-07 mr1246_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918542688 3.49E-06 2.03E-36 mr1598_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918542688 NA 1.14E-11 mr1728_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918542688 NA 7.77E-11 mr1734_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918542688 NA 2.45E-16 mr1744_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918542688 NA 2.37E-10 mr1782_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918542688 NA 1.44E-06 mr1834_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251