Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0918511304:

Variant ID: vg0918511304 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 18511304
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.93, A: 0.07, others allele: 0.00, population size: 120. )

Flanking Sequence (100 bp) in Reference Genome:

CTCACATTCATATATATGTTAATCAATTTAGACATATATGTGTGCCTAGAATCATTAACATCTATATGAATGTGGGCAATGTTAGAAAGTCTTATAACCT[A/G]
AAACGGAGATAGTAGTAAGCATTTTGTAGTGAGTCCTACATACTTTTTAATTGTGGTATGACTTATGTTTGGCTTTTCTTTTTTTTTTTAGATAGTCTCA

Reverse complement sequence

TGAGACTATCTAAAAAAAAAAAGAAAAGCCAAACATAAGTCATACCACAATTAAAAAGTATGTAGGACTCACTACAAAATGCTTACTACTATCTCCGTTT[T/C]
AGGTTATAAGACTTTCTAACATTGCCCACATTCATATAGATGTTAATGATTCTAGGCACACATATATGTCTAAATTGATTAACATATATATGAATGTGAG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	56.70%	42.80%	0.19%	0.34%	NA
All Indica	2759	91.00%	8.20%	0.29%	0.47%	NA
All Japonica	1512	5.80%	94.10%	0.00%	0.07%	NA
Aus	269	15.20%	84.80%	0.00%	0.00%	NA
Indica I	595	93.60%	5.70%	0.34%	0.34%	NA
Indica II	465	94.80%	4.30%	0.22%	0.65%	NA
Indica III	913	92.10%	7.30%	0.22%	0.33%	NA
Indica Intermediate	786	85.50%	13.50%	0.38%	0.64%	NA
Temperate Japonica	767	8.30%	91.70%	0.00%	0.00%	NA
Tropical Japonica	504	3.60%	96.40%	0.00%	0.00%	NA
Japonica Intermediate	241	2.50%	97.10%	0.00%	0.41%	NA
VI/Aromatic	96	14.60%	85.40%	0.00%	0.00%	NA
Intermediate	90	26.70%	70.00%	1.11%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0918511304	A -> G	LOC_Os09g30410.1	upstream_gene_variant ; 515.0bp to feature; MODIFIER	silent_mutation	Average:72.586; most accessible tissue: Callus, score: 90.75	N	N	N	N
vg0918511304	A -> G	LOC_Os09g30410.2	upstream_gene_variant ; 515.0bp to feature; MODIFIER	silent_mutation	Average:72.586; most accessible tissue: Callus, score: 90.75	N	N	N	N
vg0918511304	A -> G	LOC_Os09g30411.1	downstream_gene_variant ; 478.0bp to feature; MODIFIER	silent_mutation	Average:72.586; most accessible tissue: Callus, score: 90.75	N	N	N	N
vg0918511304	A -> G	LOC_Os09g30412.1	downstream_gene_variant ; 3268.0bp to feature; MODIFIER	silent_mutation	Average:72.586; most accessible tissue: Callus, score: 90.75	N	N	N	N
vg0918511304	A -> G	LOC_Os09g30410-LOC_Os09g30411	intergenic_region ; MODIFIER	silent_mutation	Average:72.586; most accessible tissue: Callus, score: 90.75	N	N	N	N
vg0918511304	A -> DEL	N	N	silent_mutation	Average:72.586; most accessible tissue: Callus, score: 90.75	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0918511304	NA	9.84E-11	mr1151	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918511304	2.63E-06	2.63E-06	mr1151	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918511304	NA	1.24E-06	mr1216	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918511304	NA	1.06E-07	mr1249	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918511304	2.47E-06	1.23E-21	mr1598	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918511304	NA	2.05E-08	mr1707	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918511304	NA	4.20E-06	mr1707	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918511304	NA	1.32E-10	mr1751	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918511304	NA	6.82E-06	mr1047_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918511304	NA	1.08E-12	mr1189_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918511304	NA	7.25E-06	mr1189_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918511304	NA	1.54E-06	mr1246_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918511304	NA	5.34E-36	mr1598_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918511304	NA	4.42E-11	mr1728_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918511304	NA	4.07E-15	mr1744_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918511304	NA	9.08E-09	mr1751_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918511304	NA	3.24E-10	mr1782_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918511304	NA	2.89E-06	mr1834_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251