Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0918502977:

Variant ID: vg0918502977 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 18502977
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AGCACAATGCTACAAAAAAAATATGAACAGTAAAACGGATCATTTATGTGATGGACGCACCTTAAACAATATGGACAAATAATTTTTAAGTCATTACACA[A/G]
TTATCTGTCAAATTAAGAATTTTGACGGTTAAAGTCAAAACAATAATAGTCAGTACGGAAAAATATTTGGAAACCCGGGGGGGGGGGGGTATTACTTCGG

Reverse complement sequence

CCGAAGTAATACCCCCCCCCCCCCGGGTTTCCAAATATTTTTCCGTACTGACTATTATTGTTTTGACTTTAACCGTCAAAATTCTTAATTTGACAGATAA[T/C]
TGTGTAATGACTTAAAAATTATTTGTCCATATTGTTTAAGGTGCGTCCATCACATAAATGATCCGTTTTACTGTTCATATTTTTTTTGTAGCATTGTGCT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	94.10%	3.60%	2.26%	0.00%	NA
All Indica	2759	90.00%	6.10%	3.84%	0.00%	NA
All Japonica	1512	100.00%	0.00%	0.00%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	72.60%	15.80%	11.60%	0.00%	NA
Indica II	465	95.30%	3.00%	1.72%	0.00%	NA
Indica III	913	99.60%	0.40%	0.00%	0.00%	NA
Indica Intermediate	786	89.10%	7.30%	3.69%	0.00%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	96.70%	2.20%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0918502977	A -> G	LOC_Os09g30400.1	upstream_gene_variant ; 1713.0bp to feature; MODIFIER	silent_mutation	Average:43.776; most accessible tissue: Callus, score: 76.131	N	N	N	N
vg0918502977	A -> G	LOC_Os09g30400.2	upstream_gene_variant ; 2538.0bp to feature; MODIFIER	silent_mutation	Average:43.776; most accessible tissue: Callus, score: 76.131	N	N	N	N
vg0918502977	A -> G	LOC_Os09g30400.3	upstream_gene_variant ; 2398.0bp to feature; MODIFIER	silent_mutation	Average:43.776; most accessible tissue: Callus, score: 76.131	N	N	N	N
vg0918502977	A -> G	LOC_Os09g30400-LOC_Os09g30410	intergenic_region ; MODIFIER	silent_mutation	Average:43.776; most accessible tissue: Callus, score: 76.131	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0918502977	NA	3.31E-10	mr1138	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918502977	NA	1.13E-06	mr1354	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918502977	NA	1.55E-13	mr1707	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918502977	NA	9.54E-09	mr1707	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918502977	3.53E-06	8.52E-20	mr1728	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918502977	NA	3.90E-13	mr1728	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918502977	NA	6.07E-13	mr1860	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918502977	NA	5.16E-09	mr1860	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918502977	2.53E-06	NA	mr1138_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918502977	NA	1.25E-08	mr1138_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918502977	NA	4.57E-08	mr1458_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918502977	4.88E-08	2.68E-16	mr1707_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918502977	3.36E-06	2.56E-10	mr1707_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918502977	1.90E-09	3.43E-24	mr1728_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918502977	1.26E-07	1.76E-14	mr1728_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918502977	NA	1.39E-13	mr1860_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918502977	NA	4.94E-09	mr1860_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251