\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0918502977:

Variant ID: vg0918502977 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 18502977
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AGCACAATGCTACAAAAAAAATATGAACAGTAAAACGGATCATTTATGTGATGGACGCACCTTAAACAATATGGACAAATAATTTTTAAGTCATTACACA[A/G]
TTATCTGTCAAATTAAGAATTTTGACGGTTAAAGTCAAAACAATAATAGTCAGTACGGAAAAATATTTGGAAACCCGGGGGGGGGGGGGTATTACTTCGG

Reverse complement sequence

CCGAAGTAATACCCCCCCCCCCCCGGGTTTCCAAATATTTTTCCGTACTGACTATTATTGTTTTGACTTTAACCGTCAAAATTCTTAATTTGACAGATAA[T/C]
TGTGTAATGACTTAAAAATTATTTGTCCATATTGTTTAAGGTGCGTCCATCACATAAATGATCCGTTTTACTGTTCATATTTTTTTTGTAGCATTGTGCT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 94.10% 3.60% 2.26% 0.00% NA
All Indica  2759 90.00% 6.10% 3.84% 0.00% NA
All Japonica  1512 100.00% 0.00% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 72.60% 15.80% 11.60% 0.00% NA
Indica II  465 95.30% 3.00% 1.72% 0.00% NA
Indica III  913 99.60% 0.40% 0.00% 0.00% NA
Indica Intermediate  786 89.10% 7.30% 3.69% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 96.70% 2.20% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0918502977 A -> G LOC_Os09g30400.1 upstream_gene_variant ; 1713.0bp to feature; MODIFIER silent_mutation Average:43.776; most accessible tissue: Callus, score: 76.131 N N N N
vg0918502977 A -> G LOC_Os09g30400.2 upstream_gene_variant ; 2538.0bp to feature; MODIFIER silent_mutation Average:43.776; most accessible tissue: Callus, score: 76.131 N N N N
vg0918502977 A -> G LOC_Os09g30400.3 upstream_gene_variant ; 2398.0bp to feature; MODIFIER silent_mutation Average:43.776; most accessible tissue: Callus, score: 76.131 N N N N
vg0918502977 A -> G LOC_Os09g30400-LOC_Os09g30410 intergenic_region ; MODIFIER silent_mutation Average:43.776; most accessible tissue: Callus, score: 76.131 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0918502977 NA 3.31E-10 mr1138 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918502977 NA 1.13E-06 mr1354 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918502977 NA 1.55E-13 mr1707 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918502977 NA 9.54E-09 mr1707 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918502977 3.53E-06 8.52E-20 mr1728 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918502977 NA 3.90E-13 mr1728 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918502977 NA 6.07E-13 mr1860 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918502977 NA 5.16E-09 mr1860 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918502977 2.53E-06 NA mr1138_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918502977 NA 1.25E-08 mr1138_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918502977 NA 4.57E-08 mr1458_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918502977 4.88E-08 2.68E-16 mr1707_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918502977 3.36E-06 2.56E-10 mr1707_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918502977 1.90E-09 3.43E-24 mr1728_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918502977 1.26E-07 1.76E-14 mr1728_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918502977 NA 1.39E-13 mr1860_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918502977 NA 4.94E-09 mr1860_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251