\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0918487266:

Variant ID: vg0918487266 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 18487266
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.59, T: 0.41, others allele: 0.00, population size: 101. )

Flanking Sequence (100 bp) in Reference Genome:


AATAGAGACAAAGAATTCGTGGTTAAATCTATAAATGATAGCCGATCGGCTAGGTGCCGATGACATATCATTTATCTTTGAGCCGATGTCATATATGAAT[T/C]
GATCGGCGGTTATAAATAGATAGTAAGGAACTAGATCTATTCGATCGGCTGTAGATATTAACGATATATAGTTCTTATATTAATATATACTTAAATCAAG

Reverse complement sequence

CTTGATTTAAGTATATATTAATATAAGAACTATATATCGTTAATATCTACAGCCGATCGAATAGATCTAGTTCCTTACTATCTATTTATAACCGCCGATC[A/G]
ATTCATATATGACATCGGCTCAAAGATAAATGATATGTCATCGGCACCTAGCCGATCGGCTATCATTTATAGATTTAACCACGAATTCTTTGTCTCTATT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 53.40% 46.20% 0.42% 0.00% NA
All Indica  2759 89.20% 10.20% 0.62% 0.00% NA
All Japonica  1512 0.20% 99.70% 0.07% 0.00% NA
Aus  269 14.90% 85.10% 0.00% 0.00% NA
Indica I  595 91.80% 6.40% 1.85% 0.00% NA
Indica II  465 93.10% 6.20% 0.65% 0.00% NA
Indica III  913 91.80% 8.20% 0.00% 0.00% NA
Indica Intermediate  786 81.90% 17.70% 0.38% 0.00% NA
Temperate Japonica  767 0.10% 99.70% 0.13% 0.00% NA
Tropical Japonica  504 0.20% 99.80% 0.00% 0.00% NA
Japonica Intermediate  241 0.40% 99.60% 0.00% 0.00% NA
VI/Aromatic  96 0.00% 100.00% 0.00% 0.00% NA
Intermediate  90 22.20% 75.60% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0918487266 T -> C LOC_Os09g30380.1 upstream_gene_variant ; 4460.0bp to feature; MODIFIER silent_mutation Average:43.493; most accessible tissue: Minghui63 panicle, score: 68.46 N N N N
vg0918487266 T -> C LOC_Os09g30370.1 downstream_gene_variant ; 2479.0bp to feature; MODIFIER silent_mutation Average:43.493; most accessible tissue: Minghui63 panicle, score: 68.46 N N N N
vg0918487266 T -> C LOC_Os09g30370-LOC_Os09g30380 intergenic_region ; MODIFIER silent_mutation Average:43.493; most accessible tissue: Minghui63 panicle, score: 68.46 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0918487266 NA 5.24E-30 mr1208 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918487266 NA 2.71E-31 mr1224 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918487266 NA 1.84E-13 mr1233 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918487266 NA 1.12E-09 mr1342 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918487266 NA 1.06E-28 mr1436 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918487266 NA 4.41E-08 mr1559 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918487266 NA 2.13E-21 mr1598 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918487266 NA 1.66E-39 mr1620 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918487266 NA 7.48E-13 mr1657 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918487266 NA 1.67E-07 mr1707 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918487266 NA 6.70E-41 mr1208_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918487266 NA 6.37E-36 mr1224_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918487266 NA 6.08E-27 mr1233_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918487266 NA 1.85E-06 mr1233_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918487266 NA 2.62E-06 mr1346_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918487266 6.10E-07 NA mr1557_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918487266 NA 4.69E-07 mr1559_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918487266 1.18E-10 7.51E-42 mr1598_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918487266 NA 4.13E-10 mr1649_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918487266 NA 6.26E-15 mr1720_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918487266 NA 1.18E-15 mr1744_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918487266 NA 2.35E-25 mr1949_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918487266 NA 8.51E-08 mr1949_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251