\
| Variant ID: vg0918467471 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 18467471 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
TAGAACAACAAAAAGTGTATCTTCTGTTCAAATAATTCACCACACCAAATATCTCTTTCAGATTTTGTCTTTTCAGCCACAGTCTTATTTTACTGTATAA[T/C]
TATTTATAACCACTTCTTTTGAATACCCATTTTTGCTCTTGCAGGGAACATGGCAATTAGTTTTCATGGCACTCTGACTGGAAGGACTTTGAGCAATTTC
GAAATTGCTCAAAGTCCTTCCAGTCAGAGTGCCATGAAAACTAATTGCCATGTTCCCTGCAAGAGCAAAAATGGGTATTCAAAAGAAGTGGTTATAAATA[A/G]
TTATACAGTAAAATAAGACTGTGGCTGAAAAGACAAAATCTGAAAGAGATATTTGGTGTGGTGAATTATTTGAACAGAAGATACACTTTTTGTTGTTCTA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 96.60% | 2.30% | 1.16% | 0.00% | NA |
| All Indica | 2759 | 94.20% | 3.80% | 1.99% | 0.00% | NA |
| All Japonica | 1512 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 84.50% | 9.40% | 6.05% | 0.00% | NA |
| Indica II | 465 | 96.10% | 2.80% | 1.08% | 0.00% | NA |
| Indica III | 913 | 99.80% | 0.00% | 0.22% | 0.00% | NA |
| Indica Intermediate | 786 | 94.00% | 4.50% | 1.53% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 97.80% | 2.20% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0918467471 | T -> C | LOC_Os09g30340.1 | upstream_gene_variant ; 2231.0bp to feature; MODIFIER | silent_mutation | Average:47.424; most accessible tissue: Callus, score: 88.203 | N | N | N | N |
| vg0918467471 | T -> C | LOC_Os09g30350.1 | downstream_gene_variant ; 2231.0bp to feature; MODIFIER | silent_mutation | Average:47.424; most accessible tissue: Callus, score: 88.203 | N | N | N | N |
| vg0918467471 | T -> C | LOC_Os09g30330.1 | intron_variant ; MODIFIER | silent_mutation | Average:47.424; most accessible tissue: Callus, score: 88.203 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0918467471 | 2.47E-07 | 2.28E-12 | mr1138 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0918467471 | NA | 1.95E-12 | mr1707 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0918467471 | 2.46E-08 | 2.73E-18 | mr1728 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0918467471 | 9.41E-06 | 1.62E-10 | mr1860 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0918467471 | 5.20E-06 | 3.58E-09 | mr1138_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0918467471 | 9.85E-10 | 1.52E-14 | mr1707_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0918467471 | 4.11E-13 | 1.12E-22 | mr1728_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0918467471 | 3.10E-06 | 1.00E-11 | mr1860_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |