\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0918422796:

Variant ID: vg0918422796 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 18422796
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.00, others allele: 0.00, population size: 295. )

Flanking Sequence (100 bp) in Reference Genome:


AATAGCAATTCATGTCATCGAAAACGGTGACATTAAATTGGTTATTCATAGTATCGATGACATTTTTTCGCGAAGTCTAGGTGGCATTTCCTTCCAATCG[G/A]
GGTGTAGGATTTATCAGCGGTCTTAAGTGTGTGGGGTTGTTTGGTTTGTACCTTAGCATTGGTGGTGCGTAACATGTAGCTAAGGGTGGACAAAAAACTC

Reverse complement sequence

GAGTTTTTTGTCCACCCTTAGCTACATGTTACGCACCACCAATGCTAAGGTACAAACCAAACAACCCCACACACTTAAGACCGCTGATAAATCCTACACC[C/T]
CGATTGGAAGGAAATGCCACCTAGACTTCGCGAAAAAATGTCATCGATACTATGAATAACCAATTTAATGTCACCGTTTTCGATGACATGAATTGCTATT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 85.20% 14.00% 0.85% 0.00% NA
All Indica  2759 92.90% 6.10% 1.05% 0.00% NA
All Japonica  1512 87.70% 11.80% 0.53% 0.00% NA
Aus  269 16.70% 82.90% 0.37% 0.00% NA
Indica I  595 92.30% 5.40% 2.35% 0.00% NA
Indica II  465 99.10% 0.40% 0.43% 0.00% NA
Indica III  913 94.20% 5.50% 0.33% 0.00% NA
Indica Intermediate  786 88.00% 10.70% 1.27% 0.00% NA
Temperate Japonica  767 98.80% 1.20% 0.00% 0.00% NA
Tropical Japonica  504 67.10% 31.50% 1.39% 0.00% NA
Japonica Intermediate  241 95.40% 4.10% 0.41% 0.00% NA
VI/Aromatic  96 28.10% 70.80% 1.04% 0.00% NA
Intermediate  90 72.20% 26.70% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0918422796 G -> A LOC_Os09g30260.1 upstream_gene_variant ; 4256.0bp to feature; MODIFIER silent_mutation Average:76.841; most accessible tissue: Callus, score: 99.199 N N N N
vg0918422796 G -> A LOC_Os09g30250.1 downstream_gene_variant ; 27.0bp to feature; MODIFIER silent_mutation Average:76.841; most accessible tissue: Callus, score: 99.199 N N N N
vg0918422796 G -> A LOC_Os09g30250-LOC_Os09g30260 intergenic_region ; MODIFIER silent_mutation Average:76.841; most accessible tissue: Callus, score: 99.199 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0918422796 G A 0.0 0.0 0.0 -0.01 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0918422796 NA 9.86E-06 mr1277 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918422796 NA 6.06E-07 mr1382 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918422796 NA 8.49E-08 mr1746 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918422796 NA 9.82E-07 mr1951 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918422796 NA 1.89E-09 mr1980 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918422796 NA 1.13E-06 mr1236_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918422796 NA 2.49E-10 mr1378_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918422796 NA 4.22E-19 mr1794_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251