Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0918374002:

Variant ID: vg0918374002 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 18374002
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.97, T: 0.04, others allele: 0.00, population size: 227. )

Flanking Sequence (100 bp) in Reference Genome:


CAGGGGTGAGAAAAAAACTTTTTTTTTCAAGAATTGTGCTTTGGATTATAAAGTTGTAACTTTGATGTTGAAATGGTAATCACTCAAACCCCACAGAGAT[T/C]
TACCAGCCGTAGTGATGGTGCTAGGTCGAGATCGACCGATCAATTTAACTAATGACAAAAGTAAAGGATTTTGACAAATGGGTATTAAACTGAACAAATG

Reverse complement sequence

CATTTGTTCAGTTTAATACCCATTTGTCAAAATCCTTTACTTTTGTCATTAGTTAAATTGATCGGTCGATCTCGACCTAGCACCATCACTACGGCTGGTA[A/G]
ATCTCTGTGGGGTTTGAGTGATTACCATTTCAACATCAAAGTTACAACTTTATAATCCAAAGCACAATTCTTGAAAAAAAAAGTTTTTTTCTCACCCCTG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 77.30% 22.50% 0.30% 0.00% NA
All Indica  2759 63.00% 36.50% 0.47% 0.00% NA
All Japonica  1512 99.90% 0.10% 0.00% 0.00% NA
Aus  269 83.60% 16.40% 0.00% 0.00% NA
Indica I  595 53.90% 45.40% 0.67% 0.00% NA
Indica II  465 89.00% 10.50% 0.43% 0.00% NA
Indica III  913 49.80% 49.80% 0.33% 0.00% NA
Indica Intermediate  786 69.70% 29.80% 0.51% 0.00% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 91.10% 7.80% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0918374002 T -> C LOC_Os09g30190.1 upstream_gene_variant ; 1694.0bp to feature; MODIFIER silent_mutation Average:42.08; most accessible tissue: Zhenshan97 root, score: 84.212 N N N N
vg0918374002 T -> C LOC_Os09g30180-LOC_Os09g30190 intergenic_region ; MODIFIER silent_mutation Average:42.08; most accessible tissue: Zhenshan97 root, score: 84.212 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0918374002 T C 0.1 0.04 0.03 0.02 0.1 0.07

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0918374002 NA 1.85E-06 mr1231 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918374002 1.80E-06 NA mr1557 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918374002 NA 1.02E-07 mr1557 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918374002 NA 5.19E-06 mr1944 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918374002 NA 2.25E-06 mr1970 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918374002 NA 3.46E-07 mr1973 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918374002 1.18E-06 NA mr1557_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918374002 NA 1.16E-08 mr1557_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918374002 3.32E-06 NA mr1598_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918374002 NA 3.41E-06 mr1970_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918374002 NA 3.38E-07 mr1973_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251