\
| Variant ID: vg0918359050 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 18359050 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.79, A: 0.21, others allele: 0.00, population size: 100. )
TGAATGATGAGGGGTATAAGTGTCATTTATGAAAAGAGTTGTTGGTTTAAGGATAAGTTTGAACTAAAATGAAAACTTGAAGGACTAATATGGATAGATT[A/G]
AAACATCAAGGACTAAACTGAGCTTCAGTGAAACTTGGAGAACCACTTTAGCTATTCACCCTAATATAAAAAAAAGGAGTAGATGGCAAGGTGTGTCTTG
CAAGACACACCTTGCCATCTACTCCTTTTTTTTATATTAGGGTGAATAGCTAAAGTGGTTCTCCAAGTTTCACTGAAGCTCAGTTTAGTCCTTGATGTTT[T/C]
AATCTATCCATATTAGTCCTTCAAGTTTTCATTTTAGTTCAAACTTATCCTTAAACCAACAACTCTTTTCATAAATGACACTTATACCCCTCATCATTCA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 77.30% | 22.50% | 0.23% | 0.00% | NA |
| All Indica | 2759 | 63.00% | 36.60% | 0.40% | 0.00% | NA |
| All Japonica | 1512 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 83.60% | 16.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 53.80% | 45.50% | 0.67% | 0.00% | NA |
| Indica II | 465 | 89.00% | 11.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 50.10% | 49.70% | 0.22% | 0.00% | NA |
| Indica Intermediate | 786 | 69.60% | 29.80% | 0.64% | 0.00% | NA |
| Temperate Japonica | 767 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 92.20% | 7.80% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0918359050 | A -> G | LOC_Os09g30170.1 | upstream_gene_variant ; 1621.0bp to feature; MODIFIER | silent_mutation | Average:64.78; most accessible tissue: Minghui63 root, score: 81.681 | N | N | N | N |
| vg0918359050 | A -> G | LOC_Os09g30170.2 | upstream_gene_variant ; 1621.0bp to feature; MODIFIER | silent_mutation | Average:64.78; most accessible tissue: Minghui63 root, score: 81.681 | N | N | N | N |
| vg0918359050 | A -> G | LOC_Os09g30170.3 | upstream_gene_variant ; 1621.0bp to feature; MODIFIER | silent_mutation | Average:64.78; most accessible tissue: Minghui63 root, score: 81.681 | N | N | N | N |
| vg0918359050 | A -> G | LOC_Os09g30160-LOC_Os09g30170 | intergenic_region ; MODIFIER | silent_mutation | Average:64.78; most accessible tissue: Minghui63 root, score: 81.681 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0918359050 | 2.18E-06 | NA | mr1557 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0918359050 | NA | 3.66E-06 | mr1970 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0918359050 | NA | 1.61E-06 | mr1973 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0918359050 | 7.04E-07 | NA | mr1557_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0918359050 | NA | 4.27E-08 | mr1557_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |