\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0918181871:

Variant ID: vg0918181871 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 18181871
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.94, T: 0.05, others allele: 0.00, population size: 126. )

Flanking Sequence (100 bp) in Reference Genome:


TTGCTTGCTGCTGCGAAAAATGGCAGCCAAACAGACCCATTTCAAAATATAAGACACAATCGTCCTTAACTCAAATATTAAGAAACAATTATTATCATTT[C/T]
CTAATTTAGATCACTCTAATAAATACAATGCATGCATCCAATGGAGTTAGAGATCTTGAGAGTGAAGGATTTAAAAGTAATAATTCAATGGAAAAGAGGT

Reverse complement sequence

ACCTCTTTTCCATTGAATTATTACTTTTAAATCCTTCACTCTCAAGATCTCTAACTCCATTGGATGCATGCATTGTATTTATTAGAGTGATCTAAATTAG[G/A]
AAATGATAATAATTGTTTCTTAATATTTGAGTTAAGGACGATTGTGTCTTATATTTTGAAATGGGTCTGTTTGGCTGCCATTTTTCGCAGCAGCAAGCAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 87.60% 11.60% 0.78% 0.00% NA
All Indica  2759 94.40% 5.60% 0.04% 0.00% NA
All Japonica  1512 91.70% 6.20% 2.18% 0.00% NA
Aus  269 21.90% 78.10% 0.00% 0.00% NA
Indica I  595 96.30% 3.70% 0.00% 0.00% NA
Indica II  465 94.40% 5.60% 0.00% 0.00% NA
Indica III  913 94.50% 5.50% 0.00% 0.00% NA
Indica Intermediate  786 92.70% 7.10% 0.13% 0.00% NA
Temperate Japonica  767 95.70% 2.30% 1.96% 0.00% NA
Tropical Japonica  504 96.40% 3.40% 0.20% 0.00% NA
Japonica Intermediate  241 68.90% 24.10% 7.05% 0.00% NA
VI/Aromatic  96 19.80% 78.10% 2.08% 0.00% NA
Intermediate  90 78.90% 20.00% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0918181871 C -> T LOC_Os09g29890.1 upstream_gene_variant ; 2932.0bp to feature; MODIFIER silent_mutation Average:78.381; most accessible tissue: Minghui63 flower, score: 89.373 N N N N
vg0918181871 C -> T LOC_Os09g29910.1 upstream_gene_variant ; 3230.0bp to feature; MODIFIER silent_mutation Average:78.381; most accessible tissue: Minghui63 flower, score: 89.373 N N N N
vg0918181871 C -> T LOC_Os09g29890.2 upstream_gene_variant ; 3895.0bp to feature; MODIFIER silent_mutation Average:78.381; most accessible tissue: Minghui63 flower, score: 89.373 N N N N
vg0918181871 C -> T LOC_Os09g29900.1 downstream_gene_variant ; 770.0bp to feature; MODIFIER silent_mutation Average:78.381; most accessible tissue: Minghui63 flower, score: 89.373 N N N N
vg0918181871 C -> T LOC_Os09g29900-LOC_Os09g29910 intergenic_region ; MODIFIER silent_mutation Average:78.381; most accessible tissue: Minghui63 flower, score: 89.373 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0918181871 C T 0.03 0.02 0.03 0.02 0.01 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0918181871 NA 6.54E-08 mr1707 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918181871 NA 8.56E-08 mr1347_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918181871 NA 4.13E-06 mr1511_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918181871 7.84E-07 NA mr1536_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918181871 NA 8.62E-10 mr1707_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918181871 NA 4.93E-06 mr1729_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251