Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0918173779:

Variant ID: vg0918173779 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 18173779
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATAACTAATTGCACATATTACGACTAATTTACAAGATGAATTTTTTAGCCTAATTGCTTCATGATTTGATAATGTGGTGCTACAGTAAATATTTACTAAT[G/A]
ACATGTTAATTAGGCTTAATAAATTCATCTCGCGGTTTACTGACGGATTCTGTAATTATTTTTTATTAATACCCGAACATCTCATGTGATACTCTACATA

Reverse complement sequence

TATGTAGAGTATCACATGAGATGTTCGGGTATTAATAAAAAATAATTACAGAATCCGTCAGTAAACCGCGAGATGAATTTATTAAGCCTAATTAACATGT[C/T]
ATTAGTAAATATTTACTGTAGCACCACATTATCAAATCATGAAGCAATTAGGCTAAAAAATTCATCTTGTAAATTAGTCGTAATATGTGCAATTAGTTAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 92.70% 7.20% 0.11% 0.00% NA
All Indica  2759 87.60% 12.20% 0.18% 0.00% NA
All Japonica  1512 100.00% 0.00% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 65.90% 33.80% 0.34% 0.00% NA
Indica II  465 96.80% 3.20% 0.00% 0.00% NA
Indica III  913 98.90% 1.10% 0.00% 0.00% NA
Indica Intermediate  786 85.60% 14.00% 0.38% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 97.80% 2.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0918173779 G -> A LOC_Os09g29880.1 downstream_gene_variant ; 2947.0bp to feature; MODIFIER silent_mutation Average:96.45; most accessible tissue: Minghui63 flower, score: 99.306 N N N N
vg0918173779 G -> A LOC_Os09g29890.1 downstream_gene_variant ; 753.0bp to feature; MODIFIER silent_mutation Average:96.45; most accessible tissue: Minghui63 flower, score: 99.306 N N N N
vg0918173779 G -> A LOC_Os09g29890.2 downstream_gene_variant ; 753.0bp to feature; MODIFIER silent_mutation Average:96.45; most accessible tissue: Minghui63 flower, score: 99.306 N N N N
vg0918173779 G -> A LOC_Os09g29880-LOC_Os09g29890 intergenic_region ; MODIFIER silent_mutation Average:96.45; most accessible tissue: Minghui63 flower, score: 99.306 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0918173779 G A -0.01 0.0 0.0 0.01 0.01 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0918173779 1.17E-09 NA mr1138 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918173779 2.14E-08 5.22E-14 mr1138 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918173779 NA 6.62E-08 mr1354 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918173779 3.53E-09 5.15E-21 mr1707 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918173779 1.10E-07 9.66E-14 mr1707 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918173779 4.54E-17 8.81E-32 mr1728 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918173779 7.69E-14 1.07E-21 mr1728 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918173779 4.13E-07 1.36E-19 mr1860 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918173779 5.37E-07 6.19E-14 mr1860 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918173779 1.71E-11 NA mr1138_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918173779 2.42E-09 1.24E-12 mr1138_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918173779 NA 2.02E-06 mr1354_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918173779 NA 2.33E-07 mr1458_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918173779 1.49E-20 8.36E-24 mr1707_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918173779 1.10E-15 2.44E-15 mr1707_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918173779 2.77E-21 1.92E-37 mr1728_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918173779 3.65E-16 6.14E-23 mr1728_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918173779 8.53E-12 2.39E-22 mr1860_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918173779 2.97E-10 1.28E-15 mr1860_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918173779 NA 5.37E-06 mr1875_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251