Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0918096355:

Variant ID: vg0918096355 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 18096355
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ATGTAAGAATCCTATGAAATTCCTTTAGATTGGCTCAAAACTTAAGAATCTTGGAGGAATTTTAATATGAGCTTCAACCTTTTAGAAAAAGGAAAACCAT[G/A]
GGTACCTATCTCTCTTCTGATTCCTATATTTATCCAGCGCGTAGTTCCATAGGATTTAAGATGTTAGGATATTCTAATCTTGTATGATTATCAATTTAAA

Reverse complement sequence

TTTAAATTGATAATCATACAAGATTAGAATATCCTAACATCTTAAATCCTATGGAACTACGCGCTGGATAAATATAGGAATCAGAAGAGAGATAGGTACC[C/T]
ATGGTTTTCCTTTTTCTAAAAGGTTGAAGCTCATATTAAAATTCCTCCAAGATTCTTAAGTTTTGAGCCAATCTAAAGGAATTTCATAGGATTCTTACAT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	44.10%	36.00%	6.12%	13.77%	NA
All Indica	2759	62.30%	4.00%	10.26%	23.41%	NA
All Japonica	1512	0.30%	99.50%	0.13%	0.07%	NA
Aus	269	94.10%	5.90%	0.00%	0.00%	NA
Indica I	595	70.40%	7.10%	10.92%	11.60%	NA
Indica II	465	55.10%	3.40%	15.27%	26.24%	NA
Indica III	913	58.60%	2.10%	6.90%	32.42%	NA
Indica Intermediate	786	64.90%	4.20%	10.69%	20.23%	NA
Temperate Japonica	767	0.10%	99.60%	0.13%	0.13%	NA
Tropical Japonica	504	0.60%	99.20%	0.20%	0.00%	NA
Japonica Intermediate	241	0.40%	99.60%	0.00%	0.00%	NA
VI/Aromatic	96	79.20%	20.80%	0.00%	0.00%	NA
Intermediate	90	35.60%	55.60%	4.44%	4.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0918096355	G -> DEL	N	N	silent_mutation	Average:55.875; most accessible tissue: Callus, score: 72.259	N	N	N	N
vg0918096355	G -> A	LOC_Os09g29760.1	downstream_gene_variant ; 4121.0bp to feature; MODIFIER	silent_mutation	Average:55.875; most accessible tissue: Callus, score: 72.259	N	N	N	N
vg0918096355	G -> A	LOC_Os09g29780.1	downstream_gene_variant ; 439.0bp to feature; MODIFIER	silent_mutation	Average:55.875; most accessible tissue: Callus, score: 72.259	N	N	N	N
vg0918096355	G -> A	LOC_Os09g29790.1	downstream_gene_variant ; 4849.0bp to feature; MODIFIER	silent_mutation	Average:55.875; most accessible tissue: Callus, score: 72.259	N	N	N	N
vg0918096355	G -> A	LOC_Os09g29780.2	downstream_gene_variant ; 2308.0bp to feature; MODIFIER	silent_mutation	Average:55.875; most accessible tissue: Callus, score: 72.259	N	N	N	N
vg0918096355	G -> A	LOC_Os09g29760-LOC_Os09g29780	intergenic_region ; MODIFIER	silent_mutation	Average:55.875; most accessible tissue: Callus, score: 72.259	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0918096355	NA	2.96E-06	mr1201	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918096355	NA	1.18E-07	mr1219	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918096355	NA	1.85E-07	mr1274	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918096355	NA	1.94E-06	mr1006_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918096355	1.11E-06	NA	mr1037_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918096355	NA	2.75E-07	mr1201_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918096355	NA	3.29E-10	mr1219_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918096355	NA	6.50E-07	mr1274_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918096355	NA	2.15E-11	mr1377_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918096355	NA	1.56E-19	mr1637_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251