\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0918033763:

Variant ID: vg0918033763 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 18033763
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATTAATGACTCCCCAAACTGAGTTATCTTTGAATTATTCCAAATTTAGGAACTATTTTATCATGAAAACTAGCAAATTTGAAGGCTTGTACCTTCTTCTT[C/T]
TTTTTTTGACCGAAGAGGCTTGTACGTACTTTTGAATGTCTCAACATTTTAATAACAGTACCCTATAGTACTTAAAAAACGATTTTGAAAATTTCTTGAT

Reverse complement sequence

ATCAAGAAATTTTCAAAATCGTTTTTTAAGTACTATAGGGTACTGTTATTAAAATGTTGAGACATTCAAAAGTACGTACAAGCCTCTTCGGTCAAAAAAA[G/A]
AAGAAGAAGGTACAAGCCTTCAAATTTGCTAGTTTTCATGATAAAATAGTTCCTAAATTTGGAATAATTCAAAGATAACTCAGTTTGGGGAGTCATTAAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 77.30% 22.00% 0.42% 0.28% NA
All Indica  2759 76.80% 22.90% 0.36% 0.00% NA
All Japonica  1512 91.90% 6.70% 0.60% 0.86% NA
Aus  269 20.40% 79.60% 0.00% 0.00% NA
Indica I  595 44.70% 55.10% 0.17% 0.00% NA
Indica II  465 93.10% 6.70% 0.22% 0.00% NA
Indica III  913 95.90% 3.70% 0.33% 0.00% NA
Indica Intermediate  786 69.10% 30.30% 0.64% 0.00% NA
Temperate Japonica  767 87.60% 12.40% 0.00% 0.00% NA
Tropical Japonica  504 97.20% 0.60% 0.60% 1.59% NA
Japonica Intermediate  241 94.20% 1.20% 2.49% 2.07% NA
VI/Aromatic  96 21.90% 77.10% 1.04% 0.00% NA
Intermediate  90 75.60% 24.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0918033763 C -> DEL N N silent_mutation Average:47.446; most accessible tissue: Zhenshan97 root, score: 84.212 N N N N
vg0918033763 C -> T LOC_Os09g29660.1 upstream_gene_variant ; 358.0bp to feature; MODIFIER silent_mutation Average:47.446; most accessible tissue: Zhenshan97 root, score: 84.212 N N N N
vg0918033763 C -> T LOC_Os09g29650-LOC_Os09g29660 intergenic_region ; MODIFIER silent_mutation Average:47.446; most accessible tissue: Zhenshan97 root, score: 84.212 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0918033763 NA 1.49E-13 mr1010 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918033763 NA 1.44E-07 mr1280 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918033763 6.03E-06 3.40E-12 mr1342 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918033763 NA 9.10E-21 mr1541 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918033763 NA 5.70E-24 mr1548 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918033763 NA 4.73E-26 mr1617 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918033763 NA 2.57E-09 mr1637 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918033763 NA 1.43E-09 mr1648 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918033763 NA 7.70E-06 mr1652 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918033763 NA 1.65E-11 mr1713 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918033763 NA 1.06E-31 mr1737 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918033763 NA 1.62E-06 mr1761 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918033763 NA 8.20E-06 mr1788 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918033763 NA 7.86E-07 mr1807 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918033763 NA 8.87E-11 mr1905 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918033763 NA 2.94E-20 mr1010_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918033763 NA 7.04E-26 mr1051_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918033763 NA 2.57E-18 mr1342_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918033763 NA 1.08E-13 mr1713_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918033763 NA 6.79E-10 mr1761_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918033763 NA 5.17E-06 mr1788_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251