\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0918030519:

Variant ID: vg0918030519 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 18030519
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AGTAGACACCCTATCGAACACTTGCTCCAAATATATGTGCTGGCGTCGACATTAGGCTTTGGCACCAGACATCGCCGAACTCCGAGATTGCTAGTTCGCG[T/C]
GCGCGTTACCGGCGCTTACTTCCGGCCCACAAGGTCCACGGTACGTGCACACGTTTCTTCTATTCTTTTTCTTTTTTTTTCGCAGTTTTTTTCTACCGCT

Reverse complement sequence

AGCGGTAGAAAAAAACTGCGAAAAAAAAAGAAAAAGAATAGAAGAAACGTGTGCACGTACCGTGGACCTTGTGGGCCGGAAGTAAGCGCCGGTAACGCGC[A/G]
CGCGAACTAGCAATCTCGGAGTTCGGCGATGTCTGGTGCCAAAGCCTAATGTCGACGCCAGCACATATATTTGGAGCAAGTGTTCGATAGGGTGTCTACT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 84.40% 13.80% 1.76% 0.00% NA
All Indica  2759 98.90% 0.70% 0.36% 0.00% NA
All Japonica  1512 55.20% 40.20% 4.56% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 99.20% 0.20% 0.67% 0.00% NA
Indica II  465 96.80% 3.20% 0.00% 0.00% NA
Indica III  913 99.90% 0.10% 0.00% 0.00% NA
Indica Intermediate  786 98.90% 0.40% 0.76% 0.00% NA
Temperate Japonica  767 32.30% 62.10% 5.61% 0.00% NA
Tropical Japonica  504 90.70% 6.50% 2.78% 0.00% NA
Japonica Intermediate  241 53.90% 41.10% 4.98% 0.00% NA
VI/Aromatic  96 94.80% 5.20% 0.00% 0.00% NA
Intermediate  90 73.30% 22.20% 4.44% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0918030519 T -> C LOC_Os09g29660.1 upstream_gene_variant ; 3602.0bp to feature; MODIFIER silent_mutation Average:72.337; most accessible tissue: Callus, score: 94.498 N N N N
vg0918030519 T -> C LOC_Os09g29650.1 downstream_gene_variant ; 3255.0bp to feature; MODIFIER silent_mutation Average:72.337; most accessible tissue: Callus, score: 94.498 N N N N
vg0918030519 T -> C LOC_Os09g29650-LOC_Os09g29660 intergenic_region ; MODIFIER silent_mutation Average:72.337; most accessible tissue: Callus, score: 94.498 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0918030519 T C -0.04 -0.03 -0.03 -0.01 -0.07 -0.07

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0918030519 NA 2.82E-15 Heading_date All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0918030519 NA 1.71E-19 Heading_date Jap_All YES Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0918030519 NA 3.05E-14 Plant_height Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0918030519 NA 3.69E-13 Spikelet_length Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0918030519 NA 9.55E-10 mr1002_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918030519 NA 2.42E-06 mr1045_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918030519 NA 5.38E-06 mr1051_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918030519 NA 5.49E-06 mr1053_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918030519 NA 4.61E-06 mr1263_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918030519 NA 6.02E-08 mr1263_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918030519 NA 2.90E-07 mr1354_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918030519 NA 2.64E-06 mr1359_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918030519 NA 7.21E-09 mr1482_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918030519 NA 1.81E-06 mr1567_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918030519 NA 1.63E-06 mr1588_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918030519 NA 9.05E-07 mr1648_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918030519 NA 1.17E-08 mr1829_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918030519 NA 7.87E-06 mr1829_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918030519 NA 5.04E-07 mr1865_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918030519 NA 1.67E-06 mr1902_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251