\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0917927669:

Variant ID: vg0917927669 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 17927669
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.73, G: 0.27, others allele: 0.00, population size: 94. )

Flanking Sequence (100 bp) in Reference Genome:


TTTACTACTATGGACTAGCAAATGCCAAATGCCAAATTACCAACTTTTGCTACTAGTGTTTAGATCCAAAATGGCAAAAAGTGTTACAAAATGGCAAAAT[G/A]
CCATTTTGGAGGATCTAAACAAGGTCTTAGTTCAAGCATGAGCAGGATTTGCTAGAAGCGGTTCCCAATCGGAACAGTGATCACGGGAAACGGAGCAGTC

Reverse complement sequence

GACTGCTCCGTTTCCCGTGATCACTGTTCCGATTGGGAACCGCTTCTAGCAAATCCTGCTCATGCTTGAACTAAGACCTTGTTTAGATCCTCCAAAATGG[C/T]
ATTTTGCCATTTTGTAACACTTTTTGCCATTTTGGATCTAAACACTAGTAGCAAAAGTTGGTAATTTGGCATTTGGCATTTGCTAGTCCATAGTAGTAAA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 56.60% 43.30% 0.13% 0.00% NA
All Indica  2759 94.60% 5.20% 0.18% 0.00% NA
All Japonica  1512 0.10% 99.90% 0.00% 0.00% NA
Aus  269 13.80% 86.20% 0.00% 0.00% NA
Indica I  595 96.30% 3.70% 0.00% 0.00% NA
Indica II  465 95.10% 4.90% 0.00% 0.00% NA
Indica III  913 96.90% 3.00% 0.11% 0.00% NA
Indica Intermediate  786 90.30% 9.20% 0.51% 0.00% NA
Temperate Japonica  767 0.10% 99.90% 0.00% 0.00% NA
Tropical Japonica  504 0.00% 100.00% 0.00% 0.00% NA
Japonica Intermediate  241 0.40% 99.60% 0.00% 0.00% NA
VI/Aromatic  96 2.10% 97.90% 0.00% 0.00% NA
Intermediate  90 24.40% 74.40% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0917927669 G -> A LOC_Os09g29480.1 upstream_gene_variant ; 2020.0bp to feature; MODIFIER silent_mutation Average:50.893; most accessible tissue: Minghui63 panicle, score: 80.641 N N N N
vg0917927669 G -> A LOC_Os09g29480.2 upstream_gene_variant ; 2020.0bp to feature; MODIFIER silent_mutation Average:50.893; most accessible tissue: Minghui63 panicle, score: 80.641 N N N N
vg0917927669 G -> A LOC_Os09g29480.3 upstream_gene_variant ; 2020.0bp to feature; MODIFIER silent_mutation Average:50.893; most accessible tissue: Minghui63 panicle, score: 80.641 N N N N
vg0917927669 G -> A LOC_Os09g29470.1 downstream_gene_variant ; 3793.0bp to feature; MODIFIER silent_mutation Average:50.893; most accessible tissue: Minghui63 panicle, score: 80.641 N N N N
vg0917927669 G -> A LOC_Os09g29490.1 downstream_gene_variant ; 4975.0bp to feature; MODIFIER silent_mutation Average:50.893; most accessible tissue: Minghui63 panicle, score: 80.641 N N N N
vg0917927669 G -> A LOC_Os09g29470.2 downstream_gene_variant ; 4528.0bp to feature; MODIFIER silent_mutation Average:50.893; most accessible tissue: Minghui63 panicle, score: 80.641 N N N N
vg0917927669 G -> A LOC_Os09g29470.3 downstream_gene_variant ; 3793.0bp to feature; MODIFIER silent_mutation Average:50.893; most accessible tissue: Minghui63 panicle, score: 80.641 N N N N
vg0917927669 G -> A LOC_Os09g29470-LOC_Os09g29480 intergenic_region ; MODIFIER silent_mutation Average:50.893; most accessible tissue: Minghui63 panicle, score: 80.641 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0917927669 NA 1.09E-25 mr1076 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917927669 NA 1.45E-22 mr1083 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917927669 NA 2.62E-30 mr1085 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917927669 NA 5.61E-59 mr1088 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917927669 NA 2.78E-57 mr1103 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917927669 NA 5.97E-06 mr1103 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917927669 NA 1.85E-39 mr1139 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917927669 NA 2.29E-15 mr1199 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917927669 NA 6.49E-31 mr1204 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917927669 NA 5.79E-30 mr1208 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917927669 NA 6.74E-34 mr1224 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917927669 NA 3.34E-32 mr1225 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917927669 NA 7.28E-29 mr1226 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917927669 NA 3.93E-12 mr1233 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917927669 NA 2.64E-65 mr1246 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917927669 NA 1.19E-23 mr1264 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917927669 NA 1.84E-36 mr1404 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917927669 NA 7.30E-26 mr1411 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917927669 NA 2.10E-29 mr1436 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917927669 NA 9.58E-42 mr1437 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917927669 NA 9.23E-31 mr1560 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917927669 NA 9.61E-25 mr1571 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917927669 NA 3.36E-18 mr1598 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917927669 NA 7.48E-39 mr1620 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917927669 NA 2.76E-13 mr1655 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917927669 NA 9.82E-32 mr1878 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917927669 4.25E-06 4.75E-07 mr1047_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917927669 NA 1.45E-49 mr1154_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917927669 NA 1.83E-12 mr1189_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917927669 NA 7.57E-39 mr1226_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917927669 NA 9.58E-26 mr1323_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917927669 NA 1.10E-07 mr1457_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917927669 NA 2.24E-09 mr1506_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917927669 NA 2.87E-35 mr1571_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917927669 NA 5.34E-32 mr1598_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917927669 NA 2.73E-23 mr1698_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917927669 NA 5.29E-16 mr1744_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917927669 NA 4.23E-09 mr1751_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917927669 NA 1.63E-10 mr1782_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917927669 NA 1.78E-45 mr1793_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917927669 NA 2.57E-06 mr1834_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917927669 NA 1.36E-19 mr1922_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917927669 NA 1.11E-20 mr1924_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917927669 NA 4.19E-08 mr1940_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251