\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0917927607:

Variant ID: vg0917927607 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 17927607
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AGCACTAAAGTGAGAGAGAGAGAAAGAGAGAAGGAGTGGTCCCAAAGCACTTTTTGGCACAATTTACTACTATGGACTAGCAAATGCCAAATGCCAAATT[A/G]
CCAACTTTTGCTACTAGTGTTTAGATCCAAAATGGCAAAAAGTGTTACAAAATGGCAAAATGCCATTTTGGAGGATCTAAACAAGGTCTTAGTTCAAGCA

Reverse complement sequence

TGCTTGAACTAAGACCTTGTTTAGATCCTCCAAAATGGCATTTTGCCATTTTGTAACACTTTTTGCCATTTTGGATCTAAACACTAGTAGCAAAAGTTGG[T/C]
AATTTGGCATTTGGCATTTGCTAGTCCATAGTAGTAAATTGTGCCAAAAAGTGCTTTGGGACCACTCCTTCTCTCTTTCTCTCTCTCTCACTTTAGTGCT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 65.20% 34.60% 0.04% 0.11% NA
All Indica  2759 98.50% 1.30% 0.04% 0.14% NA
All Japonica  1512 0.30% 99.70% 0.00% 0.00% NA
Aus  269 92.90% 7.10% 0.00% 0.00% NA
Indica I  595 99.70% 0.20% 0.00% 0.17% NA
Indica II  465 96.60% 3.40% 0.00% 0.00% NA
Indica III  913 99.60% 0.20% 0.00% 0.22% NA
Indica Intermediate  786 97.60% 2.20% 0.13% 0.13% NA
Temperate Japonica  767 0.10% 99.90% 0.00% 0.00% NA
Tropical Japonica  504 0.60% 99.40% 0.00% 0.00% NA
Japonica Intermediate  241 0.40% 99.60% 0.00% 0.00% NA
VI/Aromatic  96 78.10% 21.90% 0.00% 0.00% NA
Intermediate  90 38.90% 58.90% 1.11% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0917927607 A -> G LOC_Os09g29480.1 upstream_gene_variant ; 2082.0bp to feature; MODIFIER silent_mutation Average:51.93; most accessible tissue: Minghui63 panicle, score: 81.412 N N N N
vg0917927607 A -> G LOC_Os09g29480.2 upstream_gene_variant ; 2082.0bp to feature; MODIFIER silent_mutation Average:51.93; most accessible tissue: Minghui63 panicle, score: 81.412 N N N N
vg0917927607 A -> G LOC_Os09g29480.3 upstream_gene_variant ; 2082.0bp to feature; MODIFIER silent_mutation Average:51.93; most accessible tissue: Minghui63 panicle, score: 81.412 N N N N
vg0917927607 A -> G LOC_Os09g29470.1 downstream_gene_variant ; 3731.0bp to feature; MODIFIER silent_mutation Average:51.93; most accessible tissue: Minghui63 panicle, score: 81.412 N N N N
vg0917927607 A -> G LOC_Os09g29470.2 downstream_gene_variant ; 4466.0bp to feature; MODIFIER silent_mutation Average:51.93; most accessible tissue: Minghui63 panicle, score: 81.412 N N N N
vg0917927607 A -> G LOC_Os09g29470.3 downstream_gene_variant ; 3731.0bp to feature; MODIFIER silent_mutation Average:51.93; most accessible tissue: Minghui63 panicle, score: 81.412 N N N N
vg0917927607 A -> G LOC_Os09g29470-LOC_Os09g29480 intergenic_region ; MODIFIER silent_mutation Average:51.93; most accessible tissue: Minghui63 panicle, score: 81.412 N N N N
vg0917927607 A -> DEL N N silent_mutation Average:51.93; most accessible tissue: Minghui63 panicle, score: 81.412 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0917927607 4.29E-06 NA mr1009 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917927607 NA 1.77E-18 mr1116 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917927607 NA 1.27E-27 mr1148 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917927607 7.84E-06 3.87E-10 mr1151 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917927607 NA 4.25E-44 mr1152 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917927607 NA 1.39E-09 mr1198 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917927607 NA 3.19E-17 mr1228 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917927607 NA 1.11E-12 mr1239 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917927607 NA 6.30E-29 mr1256 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917927607 NA 1.37E-11 mr1307 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917927607 NA 2.50E-14 mr1361 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917927607 NA 2.80E-39 mr1480 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917927607 4.16E-06 NA mr1504 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917927607 NA 2.43E-10 mr1623 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917927607 NA 2.78E-19 mr1627 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917927607 NA 1.93E-13 mr1641 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917927607 NA 5.44E-08 mr1659 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917927607 2.20E-08 NA mr1672 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917927607 NA 5.24E-06 mr1681 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917927607 6.45E-07 2.24E-62 mr1711 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917927607 7.54E-08 NA mr1750 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917927607 NA 1.88E-11 mr1751 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917927607 9.60E-06 NA mr1889 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917927607 5.38E-06 NA mr1896 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917927607 NA 1.54E-24 mr1917 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917927607 NA 2.74E-14 mr1924 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917927607 NA 7.95E-17 mr1968 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917927607 1.04E-06 NA mr1987 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917927607 NA 1.19E-16 mr1342_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917927607 NA 6.23E-24 mr1403_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251