\
| Variant ID: vg0917910484 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 17910484 |
| Reference Allele: G | Alternative Allele: T |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
ACACAAAGGCCCTGTTTGGAGGAGTAGCCGAGAGTTATTTTAAGAGCTATTTTTTTAGCTCAAGAAATAGCCCTTCAATGAAATAGCCCTTGAGCTGTTT[G/T]
GATGCAAGAGCTACTTGACCTTTAGTACACTTTCCCAATCATAACTACCCATTTTCTCTCTTTCTCCACTAGATCTTTTGTGCATGTGTCTTGGTGTGGC
GCCACACCAAGACACATGCACAAAAGATCTAGTGGAGAAAGAGAGAAAATGGGTAGTTATGATTGGGAAAGTGTACTAAAGGTCAAGTAGCTCTTGCATC[C/A]
AAACAGCTCAAGGGCTATTTCATTGAAGGGCTATTTCTTGAGCTAAAAAAATAGCTCTTAAAATAACTCTCGGCTACTCCTCCAAACAGGGCCTTTGTGT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 44.90% | 0.30% | 0.55% | 54.21% | NA |
| All Indica | 2759 | 6.70% | 0.40% | 0.83% | 92.06% | NA |
| All Japonica | 1512 | 99.90% | 0.00% | 0.00% | 0.07% | NA |
| Aus | 269 | 98.90% | 0.70% | 0.00% | 0.37% | NA |
| Indica I | 595 | 4.90% | 1.20% | 0.34% | 93.61% | NA |
| Indica II | 465 | 6.90% | 0.00% | 0.65% | 92.47% | NA |
| Indica III | 913 | 4.50% | 0.20% | 1.20% | 94.09% | NA |
| Indica Intermediate | 786 | 10.40% | 0.40% | 0.89% | 88.30% | NA |
| Temperate Japonica | 767 | 99.90% | 0.00% | 0.00% | 0.13% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 74.40% | 0.00% | 3.33% | 22.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0917910484 | G -> DEL | N | N | silent_mutation | Average:76.648; most accessible tissue: Callus, score: 93.395 | N | N | N | N |
| vg0917910484 | G -> T | LOC_Os09g29460-LOC_Os09g29470 | intergenic_region ; MODIFIER | silent_mutation | Average:76.648; most accessible tissue: Callus, score: 93.395 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0917910484 | NA | 9.98E-09 | mr1047 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0917910484 | NA | 1.41E-14 | mr1164 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0917910484 | NA | 2.08E-61 | mr1246 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0917910484 | NA | 1.01E-25 | mr1571 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0917910484 | NA | 1.75E-07 | mr1707 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0917910484 | NA | 3.49E-36 | mr1224_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0917910484 | NA | 5.01E-32 | mr1571_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0917910484 | NA | 2.51E-33 | mr1598_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |