\
| Variant ID: vg0917808340 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 17808340 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.96, A: 0.04, others allele: 0.00, population size: 80. )
AAGTGAAAACTCGCCTTGGGAGAATGAATACGGCCGCAGTGGGCGCGGGGACGAACCGGTGAGGAGCCCCACGCTCCGTCACCTGGTTTCCGTGCTCAAC[G/A]
TTTGACCGTCCGTCTTATTTGAAAAAATTATGAAAAAAAATTAAAAGACAAGTCACGCATAAAATATTAATCATGTTTTATCATCTAACAACAATAAAAA
TTTTTATTGTTGTTAGATGATAAAACATGATTAATATTTTATGCGTGACTTGTCTTTTAATTTTTTTTCATAATTTTTTCAAATAAGACGGACGGTCAAA[C/T]
GTTGAGCACGGAAACCAGGTGACGGAGCGTGGGGCTCCTCACCGGTTCGTCCCCGCGCCCACTGCGGCCGTATTCATTCTCCCAAGGCGAGTTTTCACTT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 35.40% | 10.60% | 22.66% | 31.42% | NA |
| All Indica | 2759 | 1.40% | 11.60% | 34.76% | 52.19% | NA |
| All Japonica | 1512 | 99.80% | 0.10% | 0.07% | 0.07% | NA |
| Aus | 269 | 1.90% | 52.40% | 33.83% | 11.90% | NA |
| Indica I | 595 | 0.30% | 6.70% | 42.02% | 50.92% | NA |
| Indica II | 465 | 4.10% | 9.20% | 29.46% | 57.20% | NA |
| Indica III | 913 | 0.40% | 15.30% | 32.31% | 51.92% | NA |
| Indica Intermediate | 786 | 1.90% | 12.30% | 35.24% | 50.51% | NA |
| Temperate Japonica | 767 | 99.70% | 0.00% | 0.13% | 0.13% | NA |
| Tropical Japonica | 504 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 57.30% | 33.30% | 9.38% | 0.00% | NA |
| Intermediate | 90 | 68.90% | 5.60% | 12.22% | 13.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0917808340 | G -> DEL | N | N | silent_mutation | Average:40.727; most accessible tissue: Zhenshan97 panicle, score: 73.605 | N | N | N | N |
| vg0917808340 | G -> A | LOC_Os09g29330.1 | downstream_gene_variant ; 2626.0bp to feature; MODIFIER | silent_mutation | Average:40.727; most accessible tissue: Zhenshan97 panicle, score: 73.605 | N | N | N | N |
| vg0917808340 | G -> A | LOC_Os09g29340.1 | intron_variant ; MODIFIER | silent_mutation | Average:40.727; most accessible tissue: Zhenshan97 panicle, score: 73.605 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0917808340 | NA | 2.40E-06 | mr1082 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0917808340 | NA | 2.68E-06 | mr1085 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0917808340 | NA | 6.84E-07 | mr1103 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0917808340 | NA | 3.52E-06 | mr1104 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0917808340 | NA | 5.04E-15 | mr1228 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0917808340 | NA | 1.74E-39 | mr1891 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0917808340 | NA | 1.05E-14 | mr1324_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0917808340 | 4.36E-06 | 2.39E-21 | mr1342_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0917808340 | NA | 2.10E-19 | mr1637_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |