\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0917754653:

Variant ID: vg0917754653 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 17754653
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TATATACATATATGTATATTTAATAATGAATCAAATGATAGGAATTACTTAAGTTTTTTTAATAAGACGGACGGTTAAACATATTTTAAAAAGTCAACGG[C/T]
GTCAAATATTTAGAAATGGAGGGCGTATATATGTAGAATTTACGATTTTTTATACATATAATTCTATGATTGTGATTAGTATGGAGTAGAACATTTAATT

Reverse complement sequence

AATTAAATGTTCTACTCCATACTAATCACAATCATAGAATTATATGTATAAAAAATCGTAAATTCTACATATATACGCCCTCCATTTCTAAATATTTGAC[G/A]
CCGTTGACTTTTTAAAATATGTTTAACCGTCCGTCTTATTAAAAAAACTTAAGTAATTCCTATCATTTGATTCATTATTAAATATACATATATGTATATA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 73.80% 26.00% 0.15% 0.00% NA
All Indica  2759 97.50% 2.50% 0.04% 0.00% NA
All Japonica  1512 47.90% 51.70% 0.40% 0.00% NA
Aus  269 0.70% 99.30% 0.00% 0.00% NA
Indica I  595 99.50% 0.50% 0.00% 0.00% NA
Indica II  465 98.50% 1.50% 0.00% 0.00% NA
Indica III  913 98.60% 1.40% 0.00% 0.00% NA
Indica Intermediate  786 94.10% 5.70% 0.13% 0.00% NA
Temperate Japonica  767 62.80% 36.90% 0.26% 0.00% NA
Tropical Japonica  504 8.90% 90.50% 0.60% 0.00% NA
Japonica Intermediate  241 82.20% 17.40% 0.41% 0.00% NA
VI/Aromatic  96 20.80% 79.20% 0.00% 0.00% NA
Intermediate  90 57.80% 42.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0917754653 C -> T LOC_Os09g29210.1 upstream_gene_variant ; 3381.0bp to feature; MODIFIER silent_mutation Average:52.823; most accessible tissue: Minghui63 root, score: 77.009 N N N N
vg0917754653 C -> T LOC_Os09g29210.2 upstream_gene_variant ; 3381.0bp to feature; MODIFIER silent_mutation Average:52.823; most accessible tissue: Minghui63 root, score: 77.009 N N N N
vg0917754653 C -> T LOC_Os09g29239.1 downstream_gene_variant ; 990.0bp to feature; MODIFIER silent_mutation Average:52.823; most accessible tissue: Minghui63 root, score: 77.009 N N N N
vg0917754653 C -> T LOC_Os09g29239.2 downstream_gene_variant ; 990.0bp to feature; MODIFIER silent_mutation Average:52.823; most accessible tissue: Minghui63 root, score: 77.009 N N N N
vg0917754653 C -> T LOC_Os09g29239.3 downstream_gene_variant ; 990.0bp to feature; MODIFIER silent_mutation Average:52.823; most accessible tissue: Minghui63 root, score: 77.009 N N N N
vg0917754653 C -> T LOC_Os09g29210-LOC_Os09g29239 intergenic_region ; MODIFIER silent_mutation Average:52.823; most accessible tissue: Minghui63 root, score: 77.009 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0917754653 NA 1.00E-07 mr1029 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917754653 NA 2.96E-11 mr1047 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917754653 NA 1.90E-06 mr1058 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917754653 NA 1.48E-07 mr1189 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917754653 NA 1.31E-10 mr1379 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917754653 NA 2.26E-14 mr1409 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917754653 NA 4.62E-07 mr1530 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917754653 NA 5.17E-11 mr1559 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917754653 2.40E-06 NA mr1586 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917754653 NA 2.29E-07 mr1625 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917754653 NA 4.49E-11 mr1657 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917754653 NA 2.17E-06 mr1684 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917754653 NA 1.05E-11 mr1696 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917754653 NA 5.55E-08 mr1796 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917754653 NA 1.59E-07 mr1990 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917754653 NA 2.60E-14 mr1047_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917754653 NA 2.38E-06 mr1138_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917754653 NA 1.42E-16 mr1189_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917754653 NA 1.75E-15 mr1409_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917754653 NA 2.01E-07 mr1502_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917754653 NA 1.84E-16 mr1530_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917754653 NA 2.80E-07 mr1559_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917754653 NA 3.45E-11 mr1642_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917754653 NA 5.42E-12 mr1649_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917754653 NA 1.65E-14 mr1734_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917754653 NA 2.02E-10 mr1782_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251