\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0917635521:

Variant ID: vg0917635521 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 17635521
Reference Allele: TAlternative Allele: A
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 336. )

Flanking Sequence (100 bp) in Reference Genome:


AGCCTACGAAGCTGGAGCTTGTTGGAGCCAAGTCGCCGGGAGATCTAGTCGGATCAACTCGACTACGATCCCGACGGTATCGTCGAGTTCCGCTATTCCC[T/A]
TTGTAATCTGTGGTTTCTATCATATAATCCCATATCAACTGGATTATGGCTATTACCTACCAAGGGGCCTGAACCAGTATAATCCCTGTTTCCTGTTTGC

Reverse complement sequence

GCAAACAGGAAACAGGGATTATACTGGTTCAGGCCCCTTGGTAGGTAATAGCCATAATCCAGTTGATATGGGATTATATGATAGAAACCACAGATTACAA[A/T]
GGGAATAGCGGAACTCGACGATACCGTCGGGATCGTAGTCGAGTTGATCCGACTAGATCTCCCGGCGACTTGGCTCCAACAAGCTCCAGCTTCGTAGGCT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 86.10% 13.30% 0.59% 0.00% NA
All Indica  2759 99.70% 0.30% 0.04% 0.00% NA
All Japonica  1512 63.40% 35.30% 1.39% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.60% 0.20% 0.22% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 99.10% 0.90% 0.00% 0.00% NA
Temperate Japonica  767 93.20% 5.70% 1.04% 0.00% NA
Tropical Japonica  504 11.70% 86.30% 1.98% 0.00% NA
Japonica Intermediate  241 76.30% 22.40% 1.24% 0.00% NA
VI/Aromatic  96 29.20% 68.80% 2.08% 0.00% NA
Intermediate  90 72.20% 23.30% 4.44% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0917635521 T -> A LOC_Os09g29020.1 upstream_gene_variant ; 762.0bp to feature; MODIFIER silent_mutation Average:60.548; most accessible tissue: Zhenshan97 flower, score: 78.317 N N N N
vg0917635521 T -> A LOC_Os09g29030.1 upstream_gene_variant ; 104.0bp to feature; MODIFIER silent_mutation Average:60.548; most accessible tissue: Zhenshan97 flower, score: 78.317 N N N N
vg0917635521 T -> A LOC_Os09g29010.1 downstream_gene_variant ; 1933.0bp to feature; MODIFIER silent_mutation Average:60.548; most accessible tissue: Zhenshan97 flower, score: 78.317 N N N N
vg0917635521 T -> A LOC_Os09g29020-LOC_Os09g29030 intergenic_region ; MODIFIER silent_mutation Average:60.548; most accessible tissue: Zhenshan97 flower, score: 78.317 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0917635521 NA 5.56E-06 mr1029 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917635521 NA 6.99E-09 mr1047 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917635521 NA 1.51E-07 mr1220 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917635521 NA 4.67E-15 mr1330 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917635521 NA 2.06E-09 mr1332 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917635521 NA 1.92E-08 mr1338 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917635521 NA 2.51E-06 mr1405 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917635521 NA 9.22E-06 mr1405 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917635521 NA 4.92E-13 mr1449 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917635521 NA 8.05E-12 mr1454 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917635521 NA 8.45E-13 mr1521 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917635521 NA 1.16E-06 mr1527 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917635521 NA 2.98E-08 mr1530 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917635521 NA 3.23E-23 mr1580 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917635521 NA 1.14E-09 mr1580 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917635521 NA 9.92E-06 mr1596 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917635521 NA 3.50E-10 mr1623 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917635521 NA 7.02E-07 mr1627 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917635521 NA 9.48E-09 mr1642 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917635521 NA 1.34E-06 mr1729 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917635521 NA 9.37E-18 mr1825 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917635521 NA 6.04E-07 mr1851 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917635521 NA 1.54E-12 mr1864 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917635521 NA 1.31E-06 mr1991 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917635521 2.02E-06 NA mr1181_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917635521 NA 4.26E-06 mr1211_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917635521 NA 4.00E-07 mr1347_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917635521 NA 1.75E-09 mr1398_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917635521 NA 6.62E-06 mr1438_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917635521 NA 1.29E-09 mr1530_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251