Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0917631829:

Variant ID: vg0917631829 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 17631829
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 313. )

Flanking Sequence (100 bp) in Reference Genome:


TCGACTCCACCTTGATCTAATATCCTTTTCCGATGCTGATATTAGCAAATTTGGTCGTTAACACATGCCCCCCAAGTCCGGGATATTTGATAATGTTCCG[G/A]
ATTTGCTGTGTACCGACTCCGAGCAAGTCTCGCACTCTGCCGTTTTTCGACCGTTATTCTATCGCTTTAAATACCAACCGTTGCCCTCAAAAAATCTCAC

Reverse complement sequence

GTGAGATTTTTTGAGGGCAACGGTTGGTATTTAAAGCGATAGAATAACGGTCGAAAAACGGCAGAGTGCGAGACTTGCTCGGAGTCGGTACACAGCAAAT[C/T]
CGGAACATTATCAAATATCCCGGACTTGGGGGGCATGTGTTAACGACCAAATTTGCTAATATCAGCATCGGAAAAGGATATTAGATCAAGGTGGAGTCGA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 93.70% 5.70% 0.59% 0.00% NA
All Indica  2759 98.10% 1.90% 0.04% 0.00% NA
All Japonica  1512 99.70% 0.30% 0.00% 0.00% NA
Aus  269 12.30% 78.10% 9.67% 0.00% NA
Indica I  595 99.70% 0.20% 0.17% 0.00% NA
Indica II  465 99.60% 0.40% 0.00% 0.00% NA
Indica III  913 98.60% 1.40% 0.00% 0.00% NA
Indica Intermediate  786 95.40% 4.60% 0.00% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 99.80% 0.20% 0.00% 0.00% NA
Japonica Intermediate  241 98.30% 1.70% 0.00% 0.00% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 96.70% 2.20% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0917631829 G -> A LOC_Os09g29000.1 upstream_gene_variant ; 1618.0bp to feature; MODIFIER silent_mutation Average:43.04; most accessible tissue: Zhenshan97 flag leaf, score: 61.322 N N N N
vg0917631829 G -> A LOC_Os09g29010.1 upstream_gene_variant ; 221.0bp to feature; MODIFIER silent_mutation Average:43.04; most accessible tissue: Zhenshan97 flag leaf, score: 61.322 N N N N
vg0917631829 G -> A LOC_Os09g29030.1 upstream_gene_variant ; 3796.0bp to feature; MODIFIER silent_mutation Average:43.04; most accessible tissue: Zhenshan97 flag leaf, score: 61.322 N N N N
vg0917631829 G -> A LOC_Os09g29020.1 downstream_gene_variant ; 1988.0bp to feature; MODIFIER silent_mutation Average:43.04; most accessible tissue: Zhenshan97 flag leaf, score: 61.322 N N N N
vg0917631829 G -> A LOC_Os09g29000-LOC_Os09g29010 intergenic_region ; MODIFIER silent_mutation Average:43.04; most accessible tissue: Zhenshan97 flag leaf, score: 61.322 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0917631829 NA 1.06E-06 mr1004 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917631829 NA 7.44E-08 mr1028 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917631829 NA 3.94E-07 mr1053 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917631829 NA 1.71E-23 mr1095 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917631829 NA 2.91E-31 mr1098 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917631829 NA 5.67E-29 mr1099 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917631829 NA 6.03E-28 mr1101 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917631829 NA 2.39E-16 mr1119 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917631829 NA 3.99E-21 mr1120 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917631829 NA 1.18E-23 mr1123 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917631829 NA 1.07E-07 mr1126 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917631829 NA 5.33E-23 mr1150 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917631829 NA 6.08E-06 mr1207 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917631829 NA 1.58E-06 mr1230 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917631829 NA 4.47E-15 mr1231 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917631829 NA 1.31E-17 mr1240 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917631829 NA 1.31E-21 mr1247 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917631829 NA 2.80E-06 mr1262 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917631829 NA 2.74E-06 mr1286 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917631829 4.88E-08 NA mr1304 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917631829 NA 6.28E-06 mr1331 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917631829 NA 3.22E-06 mr1345 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917631829 NA 4.53E-07 mr1365 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917631829 NA 4.51E-09 mr1369 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917631829 2.37E-08 NA mr1414 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917631829 NA 1.35E-06 mr1424 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917631829 NA 8.49E-06 mr1427 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917631829 NA 2.23E-08 mr1453 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917631829 NA 2.80E-07 mr1556 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917631829 NA 5.99E-07 mr1574 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917631829 NA 4.22E-06 mr1596 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917631829 NA 8.29E-06 mr1634 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917631829 NA 6.92E-07 mr1652 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917631829 NA 1.19E-06 mr1665 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917631829 NA 5.21E-08 mr1762 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917631829 5.41E-06 6.20E-29 mr1858 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917631829 5.19E-06 5.63E-29 mr1859 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917631829 NA 2.29E-26 mr1868 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917631829 NA 7.15E-17 mr1911 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917631829 NA 8.56E-18 mr1936 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917631829 NA 3.30E-09 mr1939 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917631829 NA 1.36E-19 mr1095_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917631829 NA 2.82E-24 mr1099_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917631829 NA 4.05E-21 mr1123_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917631829 NA 1.43E-17 mr1240_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917631829 NA 4.26E-15 mr1936_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251