\
| Variant ID: vg0917594974 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 17594974 |
| Reference Allele: G | Alternative Allele: T |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, T: 0.00, others allele: 0.00, population size: 209. )
AGAGATAAATAAAAGTGGGGAGTGTTGGCTCTCATGCAAGAGTTAACTGCACACAAACTCCAAGAAATATGCATTAAATTCATGGTGAGAGAAAGAGAGG[G/T]
GATGAAGAAAATAAAGATAACCTTATAGCCAACCTACTATACATGTTAGCTTTAACATTGACTAATAGTAAGTAGTGAGCTCTACTATTAAACTTGCTCT
AGAGCAAGTTTAATAGTAGAGCTCACTACTTACTATTAGTCAATGTTAAAGCTAACATGTATAGTAGGTTGGCTATAAGGTTATCTTTATTTTCTTCATC[C/A]
CCTCTCTTTCTCTCACCATGAATTTAATGCATATTTCTTGGAGTTTGTGTGCAGTTAACTCTTGCATGAGAGCCAACACTCCCCACTTTTATTTATCTCT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 54.00% | 45.80% | 0.19% | 0.00% | NA |
| All Indica | 2759 | 22.10% | 77.60% | 0.33% | 0.00% | NA |
| All Japonica | 1512 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Indica I | 595 | 53.90% | 45.90% | 0.17% | 0.00% | NA |
| Indica II | 465 | 8.60% | 91.40% | 0.00% | 0.00% | NA |
| Indica III | 913 | 2.80% | 97.20% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 28.40% | 70.60% | 1.02% | 0.00% | NA |
| Temperate Japonica | 767 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 78.90% | 21.10% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0917594974 | G -> T | LOC_Os09g28930-LOC_Os09g28940 | intergenic_region ; MODIFIER | silent_mutation | Average:43.152; most accessible tissue: Minghui63 panicle, score: 77.956 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0917594974 | 4.48E-06 | NA | mr1232_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0917594974 | 3.50E-06 | NA | mr1557_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0917594974 | NA | 5.03E-06 | mr1603_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0917594974 | 3.47E-06 | 1.99E-06 | mr1603_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0917594974 | 5.53E-06 | NA | mr1608_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0917594974 | 6.49E-06 | NA | mr1608_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0917594974 | NA | 2.96E-06 | mr1942_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |