Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0917503526:

Variant ID: vg0917503526 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 17503526
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, T: 0.01, others allele: 0.00, population size: 268. )

Flanking Sequence (100 bp) in Reference Genome:

TAACAGAGAAGAGACCAAGCAGTCTAAGGAAGCAAACTTCCAGTAGATACTAAACAGCAGTGGAGAATCAGATCGACAGAGTTCTACGGCAAAGCCGTGA[C/T]
GACTGAATCCTTGGGCCTCCATTGATATGCTCACCGTTTGACAGACCGGAAAGCTTTACCACAGAAATGGCACAAATTGGAGGTAAGTTGCTGAGCCGTA

Reverse complement sequence

TACGGCTCAGCAACTTACCTCCAATTTGTGCCATTTCTGTGGTAAAGCTTTCCGGTCTGTCAAACGGTGAGCATATCAATGGAGGCCCAAGGATTCAGTC[G/A]
TCACGGCTTTGCCGTAGAACTCTGTCGATCTGATTCTCCACTGCTGTTTAGTATCTACTGGAAGTTTGCTTCCTTAGACTGCTTGGTCTCTTCTCTGTTA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	54.10%	45.70%	0.04%	0.19%	NA
All Indica	2759	22.30%	77.40%	0.04%	0.33%	NA
All Japonica	1512	99.80%	0.10%	0.07%	0.00%	NA
Aus	269	98.90%	1.10%	0.00%	0.00%	NA
Indica I	595	54.50%	45.50%	0.00%	0.00%	NA
Indica II	465	8.00%	91.80%	0.00%	0.22%	NA
Indica III	913	3.60%	96.20%	0.11%	0.11%	NA
Indica Intermediate	786	28.00%	71.10%	0.00%	0.89%	NA
Temperate Japonica	767	99.70%	0.30%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	99.60%	0.00%	0.41%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	77.80%	22.20%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0917503526	C -> DEL	N	N	silent_mutation	Average:66.925; most accessible tissue: Callus, score: 93.353	N	N	N	N
vg0917503526	C -> T	LOC_Os09g28810.1	downstream_gene_variant ; 470.0bp to feature; MODIFIER	silent_mutation	Average:66.925; most accessible tissue: Callus, score: 93.353	N	N	N	N
vg0917503526	C -> T	LOC_Os09g28820.1	downstream_gene_variant ; 31.0bp to feature; MODIFIER	silent_mutation	Average:66.925; most accessible tissue: Callus, score: 93.353	N	N	N	N
vg0917503526	C -> T	LOC_Os09g28830.1	downstream_gene_variant ; 2856.0bp to feature; MODIFIER	silent_mutation	Average:66.925; most accessible tissue: Callus, score: 93.353	N	N	N	N
vg0917503526	C -> T	LOC_Os09g28810-LOC_Os09g28820	intergenic_region ; MODIFIER	silent_mutation	Average:66.925; most accessible tissue: Callus, score: 93.353	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0917503526	NA	3.04E-12	mr1034	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917503526	NA	3.42E-06	mr1058	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917503526	NA	2.30E-17	mr1138	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917503526	NA	8.80E-11	mr1138	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917503526	NA	1.19E-06	mr1354	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917503526	NA	4.09E-06	mr1568	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917503526	NA	9.20E-09	mr1637	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917503526	NA	3.14E-08	mr1707	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917503526	NA	3.08E-07	mr1716	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917503526	1.98E-06	NA	mr1728	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917503526	NA	5.36E-12	mr1728	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917503526	NA	1.26E-07	mr1860	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917503526	NA	3.69E-17	mr1138_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917503526	6.48E-06	3.30E-10	mr1138_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917503526	NA	7.12E-06	mr1707_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917503526	5.23E-09	NA	mr1728_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917503526	3.62E-08	1.25E-13	mr1728_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917503526	NA	3.85E-09	mr1860_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251