\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0917503526:

Variant ID: vg0917503526 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 17503526
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, T: 0.01, others allele: 0.00, population size: 268. )

Flanking Sequence (100 bp) in Reference Genome:


TAACAGAGAAGAGACCAAGCAGTCTAAGGAAGCAAACTTCCAGTAGATACTAAACAGCAGTGGAGAATCAGATCGACAGAGTTCTACGGCAAAGCCGTGA[C/T]
GACTGAATCCTTGGGCCTCCATTGATATGCTCACCGTTTGACAGACCGGAAAGCTTTACCACAGAAATGGCACAAATTGGAGGTAAGTTGCTGAGCCGTA

Reverse complement sequence

TACGGCTCAGCAACTTACCTCCAATTTGTGCCATTTCTGTGGTAAAGCTTTCCGGTCTGTCAAACGGTGAGCATATCAATGGAGGCCCAAGGATTCAGTC[G/A]
TCACGGCTTTGCCGTAGAACTCTGTCGATCTGATTCTCCACTGCTGTTTAGTATCTACTGGAAGTTTGCTTCCTTAGACTGCTTGGTCTCTTCTCTGTTA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 54.10% 45.70% 0.04% 0.19% NA
All Indica  2759 22.30% 77.40% 0.04% 0.33% NA
All Japonica  1512 99.80% 0.10% 0.07% 0.00% NA
Aus  269 98.90% 1.10% 0.00% 0.00% NA
Indica I  595 54.50% 45.50% 0.00% 0.00% NA
Indica II  465 8.00% 91.80% 0.00% 0.22% NA
Indica III  913 3.60% 96.20% 0.11% 0.11% NA
Indica Intermediate  786 28.00% 71.10% 0.00% 0.89% NA
Temperate Japonica  767 99.70% 0.30% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.00% 0.41% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 77.80% 22.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0917503526 C -> DEL N N silent_mutation Average:66.925; most accessible tissue: Callus, score: 93.353 N N N N
vg0917503526 C -> T LOC_Os09g28810.1 downstream_gene_variant ; 470.0bp to feature; MODIFIER silent_mutation Average:66.925; most accessible tissue: Callus, score: 93.353 N N N N
vg0917503526 C -> T LOC_Os09g28820.1 downstream_gene_variant ; 31.0bp to feature; MODIFIER silent_mutation Average:66.925; most accessible tissue: Callus, score: 93.353 N N N N
vg0917503526 C -> T LOC_Os09g28830.1 downstream_gene_variant ; 2856.0bp to feature; MODIFIER silent_mutation Average:66.925; most accessible tissue: Callus, score: 93.353 N N N N
vg0917503526 C -> T LOC_Os09g28810-LOC_Os09g28820 intergenic_region ; MODIFIER silent_mutation Average:66.925; most accessible tissue: Callus, score: 93.353 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0917503526 NA 3.04E-12 mr1034 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917503526 NA 3.42E-06 mr1058 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917503526 NA 2.30E-17 mr1138 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917503526 NA 8.80E-11 mr1138 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917503526 NA 1.19E-06 mr1354 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917503526 NA 4.09E-06 mr1568 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917503526 NA 9.20E-09 mr1637 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917503526 NA 3.14E-08 mr1707 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917503526 NA 3.08E-07 mr1716 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917503526 1.98E-06 NA mr1728 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917503526 NA 5.36E-12 mr1728 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917503526 NA 1.26E-07 mr1860 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917503526 NA 3.69E-17 mr1138_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917503526 6.48E-06 3.30E-10 mr1138_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917503526 NA 7.12E-06 mr1707_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917503526 5.23E-09 NA mr1728_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917503526 3.62E-08 1.25E-13 mr1728_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917503526 NA 3.85E-09 mr1860_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251