\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0917430047:

Variant ID: vg0917430047 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 17430047
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GGACGCATTGCTATTGCCCTTAAAGGGGTATTTGGATAAATAAGGTTAGTAGGCAATCTATAAGAATATGAAGAATCCAAGAAGCAGTTGGTTGATATCC[G/A]
TTTCTAAGAAACTCAGTTTTTATCTTCTCGTTTATTTTCTATATCTTATAAGTACAATTTCACAAAATCTAGATAAAAAGCTAAATTATTTGGGGAGCTT

Reverse complement sequence

AAGCTCCCCAAATAATTTAGCTTTTTATCTAGATTTTGTGAAATTGTACTTATAAGATATAGAAAATAAACGAGAAGATAAAAACTGAGTTTCTTAGAAA[C/T]
GGATATCAACCAACTGCTTCTTGGATTCTTCATATTCTTATAGATTGCCTACTAACCTTATTTATCCAAATACCCCTTTAAGGGCAATAGCAATGCGTCC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 95.40% 4.50% 0.08% 0.00% NA
All Indica  2759 100.00% 0.00% 0.00% 0.00% NA
All Japonica  1512 86.50% 13.20% 0.26% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 100.00% 0.00% 0.00% 0.00% NA
Temperate Japonica  767 78.00% 22.00% 0.00% 0.00% NA
Tropical Japonica  504 97.60% 1.80% 0.60% 0.00% NA
Japonica Intermediate  241 90.50% 9.10% 0.41% 0.00% NA
VI/Aromatic  96 88.50% 11.50% 0.00% 0.00% NA
Intermediate  90 95.60% 4.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0917430047 G -> A LOC_Os09g28650.1 downstream_gene_variant ; 4425.0bp to feature; MODIFIER silent_mutation Average:84.289; most accessible tissue: Callus, score: 93.782 N N N N
vg0917430047 G -> A LOC_Os09g28660.1 downstream_gene_variant ; 1354.0bp to feature; MODIFIER silent_mutation Average:84.289; most accessible tissue: Callus, score: 93.782 N N N N
vg0917430047 G -> A LOC_Os09g28670.1 downstream_gene_variant ; 1779.0bp to feature; MODIFIER silent_mutation Average:84.289; most accessible tissue: Callus, score: 93.782 N N N N
vg0917430047 G -> A LOC_Os09g28660-LOC_Os09g28670 intergenic_region ; MODIFIER silent_mutation Average:84.289; most accessible tissue: Callus, score: 93.782 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0917430047 G A -0.01 -0.04 -0.05 -0.02 -0.02 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0917430047 NA 5.55E-09 mr1057_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917430047 NA 4.63E-07 mr1127_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917430047 NA 9.42E-06 mr1159_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917430047 NA 2.25E-10 mr1624_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917430047 6.34E-06 1.52E-08 mr1736_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917430047 NA 2.45E-10 mr1741_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917430047 NA 2.61E-06 mr1785_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251